Incidental Mutation 'R6016:Mill2'
ID478598
Institutional Source Beutler Lab
Gene Symbol Mill2
Ensembl Gene ENSMUSG00000040987
Gene NameMHC I like leukocyte 2
Synonyms
MMRRC Submission 043255-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R6016 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location18839966-18865402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18856448 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 151 (S151I)
Ref Sequence ENSEMBL: ENSMUSP00000154268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072386] [ENSMUST00000072415] [ENSMUST00000206487] [ENSMUST00000227379] [ENSMUST00000228493]
Predicted Effect probably benign
Transcript: ENSMUST00000072386
AA Change: S151I

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072223
Gene: ENSMUSG00000040987
AA Change: S151I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I_3 39 224 2.5e-14 PFAM
Pfam:MHC_I 49 225 1.5e-33 PFAM
IGc1 244 316 7.82e-6 SMART
low complexity region 332 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072415
AA Change: S136I

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072246
Gene: ENSMUSG00000040987
AA Change: S136I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I 34 210 5.9e-33 PFAM
IGc1 229 301 7.82e-6 SMART
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207014
Predicted Effect probably benign
Transcript: ENSMUST00000227379
AA Change: S136I

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228493
AA Change: S151I

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules; however, it does not associate with beta-2-microglobulin or bind peptides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9b T C 15: 77,735,858 S285P probably damaging Het
Casz1 C A 4: 148,934,584 N447K probably damaging Het
Cltb T C 13: 54,606,667 T71A possibly damaging Het
Dcaf12 A G 4: 41,313,267 F93L probably damaging Het
Dnah5 T C 15: 28,327,884 Y2135H probably damaging Het
Entpd2 C T 2: 25,398,556 R191W probably damaging Het
Gm17067 G T 7: 42,708,230 P283T probably benign Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gne T C 4: 44,039,063 E532G probably damaging Het
Gsdmc3 T G 15: 63,868,412 D86A probably benign Het
Hs3st2 A G 7: 121,500,699 H256R probably damaging Het
Il19 T A 1: 130,935,981 D16V probably damaging Het
Lats2 A T 14: 57,734,175 N14K probably damaging Het
Ncapg2 G A 12: 116,426,607 R392H probably damaging Het
Nop56 T C 2: 130,276,625 probably null Het
Olfr1344 A T 7: 6,440,614 H238L probably benign Het
Olfr467 A T 7: 107,815,012 I143F probably benign Het
Olfr761 A T 17: 37,952,076 V316D probably benign Het
Pde1a T C 2: 79,865,062 R446G probably benign Het
Pes1 T A 11: 3,978,004 M552K possibly damaging Het
Plxnb2 T A 15: 89,161,022 T1074S possibly damaging Het
Psg23 G T 7: 18,612,187 H194Q probably benign Het
Rprd2 A G 3: 95,787,373 V116A probably damaging Het
Shkbp1 A G 7: 27,354,401 V124A possibly damaging Het
Slc38a8 A T 8: 119,494,305 probably null Het
Slitrk6 A G 14: 110,750,526 V583A probably benign Het
Sptbn5 G T 2: 120,050,092 noncoding transcript Het
Stab1 A T 14: 31,158,993 I614N probably damaging Het
Tgm6 A G 2: 130,141,228 T246A probably damaging Het
Tnks1bp1 T C 2: 85,052,390 L187P probably damaging Het
Vmn1r157 A G 7: 22,761,847 R51G possibly damaging Het
Vmn2r68 A T 7: 85,222,245 I610K probably damaging Het
Other mutations in Mill2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Mill2 APN 7 18856640 missense probably damaging 0.98
IGL02465:Mill2 APN 7 18858243 nonsense probably null
IGL02876:Mill2 APN 7 18856507 missense probably damaging 1.00
R1725:Mill2 UTSW 7 18840068 missense probably benign 0.04
R1945:Mill2 UTSW 7 18841494 missense probably benign 0.00
R1964:Mill2 UTSW 7 18856604 missense probably damaging 1.00
R2260:Mill2 UTSW 7 18856488 missense probably benign 0.14
R3160:Mill2 UTSW 7 18856174 missense probably benign 0.32
R3162:Mill2 UTSW 7 18856174 missense probably benign 0.32
R4302:Mill2 UTSW 7 18856531 missense probably damaging 0.98
R4946:Mill2 UTSW 7 18856683 critical splice donor site probably null
R5121:Mill2 UTSW 7 18856666 missense probably benign 0.39
R5365:Mill2 UTSW 7 18858414 missense probably benign 0.01
R5557:Mill2 UTSW 7 18855959 nonsense probably null
R5736:Mill2 UTSW 7 18858249 missense probably benign 0.01
R5998:Mill2 UTSW 7 18840064 missense probably benign 0.00
R6004:Mill2 UTSW 7 18856538 missense probably benign 0.32
R6045:Mill2 UTSW 7 18856564 missense probably benign 0.01
R6534:Mill2 UTSW 7 18856596 missense possibly damaging 0.91
R6913:Mill2 UTSW 7 18856426 missense probably null 1.00
R7386:Mill2 UTSW 7 18858290 missense probably benign 0.16
Z1088:Mill2 UTSW 7 18856399 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCTAAGCCATGATTCTGGGC -3'
(R):5'- TATCTCTGGAGGTGAGCAGG -3'

Sequencing Primer
(F):5'- ATGATTCTGGGCAGGGCAC -3'
(R):5'- GGTGAGCAGGACATATATCATCC -3'
Posted On2017-06-26