Incidental Mutation 'R6534:Mill2'
ID520277
Institutional Source Beutler Lab
Gene Symbol Mill2
Ensembl Gene ENSMUSG00000040987
Gene NameMHC I like leukocyte 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R6534 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location18839966-18865402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18856596 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 200 (D200E)
Ref Sequence ENSEMBL: ENSMUSP00000154268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072386] [ENSMUST00000072415] [ENSMUST00000206487] [ENSMUST00000227379] [ENSMUST00000228493]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072386
AA Change: D200E

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072223
Gene: ENSMUSG00000040987
AA Change: D200E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I_3 39 224 2.5e-14 PFAM
Pfam:MHC_I 49 225 1.5e-33 PFAM
IGc1 244 316 7.82e-6 SMART
low complexity region 332 354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072415
AA Change: D185E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072246
Gene: ENSMUSG00000040987
AA Change: D185E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I 34 210 5.9e-33 PFAM
IGc1 229 301 7.82e-6 SMART
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207014
Predicted Effect possibly damaging
Transcript: ENSMUST00000227379
AA Change: D185E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228493
AA Change: D200E

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules; however, it does not associate with beta-2-microglobulin or bind peptides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 A T 7: 98,226,448 L142M probably benign Het
Adgrb2 T C 4: 130,022,219 F1435L probably damaging Het
Anapc13 T C 9: 102,634,093 L60P probably damaging Het
Apaf1 T C 10: 91,056,000 D497G probably damaging Het
Arpc1b A T 5: 145,122,567 I34F probably damaging Het
Atp2a2 A T 5: 122,457,198 W1030R possibly damaging Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Ddx10 A G 9: 53,223,688 Y399H probably damaging Het
Dnah9 T C 11: 65,955,248 E2988G probably damaging Het
Dock10 T C 1: 80,503,671 I536M probably benign Het
Drc7 T C 8: 95,071,282 Y443H probably damaging Het
Ecel1 A G 1: 87,154,842 S50P probably benign Het
Esco1 T A 18: 10,594,794 Q164L possibly damaging Het
Exosc7 A G 9: 123,132,012 D248G probably benign Het
Galnt3 A G 2: 66,102,531 L201P probably damaging Het
Hand2 C A 8: 57,322,036 H44N probably benign Het
Kcnq1 C T 7: 143,194,327 P411S probably benign Het
Lonp2 A G 8: 86,716,458 D429G probably benign Het
Magi3 A G 3: 104,085,220 I312T possibly damaging Het
Mansc4 A T 6: 147,086,873 I31N probably damaging Het
Olfr74 G A 2: 87,974,041 A208V probably benign Het
Pde4d A G 13: 109,632,901 K41R probably benign Het
Pik3r5 G A 11: 68,490,617 D210N possibly damaging Het
Plcl1 C T 1: 55,696,748 T416I probably damaging Het
Plekhd1 T C 12: 80,707,257 Y166H probably damaging Het
Prrc1 A G 18: 57,389,274 T393A probably damaging Het
Scaper A T 9: 55,883,976 C213S probably benign Het
Sfxn4 T C 19: 60,839,023 I298V probably damaging Het
Slc36a2 A T 11: 55,184,867 D31E probably benign Het
Stra6l G A 4: 45,860,041 probably null Het
Tnpo3 A T 6: 29,572,703 probably null Het
Tonsl A G 15: 76,629,677 Y1231H probably damaging Het
Ush2a C A 1: 188,451,802 Y1434* probably null Het
Zfp69 T C 4: 120,931,197 Y307C probably benign Het
Other mutations in Mill2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Mill2 APN 7 18856640 missense probably damaging 0.98
IGL02465:Mill2 APN 7 18858243 nonsense probably null
IGL02876:Mill2 APN 7 18856507 missense probably damaging 1.00
R1725:Mill2 UTSW 7 18840068 missense probably benign 0.04
R1945:Mill2 UTSW 7 18841494 missense probably benign 0.00
R1964:Mill2 UTSW 7 18856604 missense probably damaging 1.00
R2260:Mill2 UTSW 7 18856488 missense probably benign 0.14
R3160:Mill2 UTSW 7 18856174 missense probably benign 0.32
R3162:Mill2 UTSW 7 18856174 missense probably benign 0.32
R4302:Mill2 UTSW 7 18856531 missense probably damaging 0.98
R4946:Mill2 UTSW 7 18856683 critical splice donor site probably null
R5121:Mill2 UTSW 7 18856666 missense probably benign 0.39
R5365:Mill2 UTSW 7 18858414 missense probably benign 0.01
R5557:Mill2 UTSW 7 18855959 nonsense probably null
R5736:Mill2 UTSW 7 18858249 missense probably benign 0.01
R5998:Mill2 UTSW 7 18840064 missense probably benign 0.00
R6004:Mill2 UTSW 7 18856538 missense probably benign 0.32
R6016:Mill2 UTSW 7 18856448 missense probably benign 0.45
R6045:Mill2 UTSW 7 18856564 missense probably benign 0.01
R6913:Mill2 UTSW 7 18856426 missense probably null 1.00
R7386:Mill2 UTSW 7 18858290 missense probably benign 0.16
Z1088:Mill2 UTSW 7 18856399 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACTTTGGGCTGTGAGCTTC -3'
(R):5'- ATGGCTGGATCCTTCTGTCC -3'

Sequencing Primer
(F):5'- CTTCTGAGTAATGGGAGCACTAG -3'
(R):5'- TCCAAGCCCAATTGTTCATAACTAG -3'
Posted On2018-06-06