Incidental Mutation 'R6019:Ska1'
ID478836
Institutional Source Beutler Lab
Gene Symbol Ska1
Ensembl Gene ENSMUSG00000036223
Gene Namespindle and kinetochore associated complex subunit 1
Synonyms
MMRRC Submission 044193-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R6019 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location74195299-74207818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74199921 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 142 (D142V)
Ref Sequence ENSEMBL: ENSMUSP00000137357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040188] [ENSMUST00000177604]
Predicted Effect probably benign
Transcript: ENSMUST00000040188
AA Change: D142V

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049156
Gene: ENSMUSG00000036223
AA Change: D142V

DomainStartEndE-ValueType
Pfam:DUF1395 15 247 2.2e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177604
AA Change: D142V

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137357
Gene: ENSMUSG00000036223
AA Change: D142V

DomainStartEndE-ValueType
Pfam:DUF1395 15 249 6.2e-106 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 96% (81/84)
MGI Phenotype A mutation in this unidentified gene results in axial skeletal defects and head tossing behavior in homozygotes.
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,552,451 H436Y possibly damaging Het
Acad10 A T 5: 121,634,801 H472Q possibly damaging Het
Ano8 G A 8: 71,482,380 R393C probably damaging Het
Arhgap18 T A 10: 26,860,650 V163E probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacng5 T C 11: 107,884,388 M52V probably benign Het
Casz1 T C 4: 148,947,038 C1249R probably damaging Het
Cenpj C T 14: 56,534,815 S1086N probably benign Het
Chil1 T C 1: 134,189,572 F367S probably benign Het
Copg2 A T 6: 30,810,933 I610N possibly damaging Het
Cpa6 T C 1: 10,595,643 K57E possibly damaging Het
D5Ertd579e C T 5: 36,629,692 A111T possibly damaging Het
Dgat2 A G 7: 99,154,631 M361T probably benign Het
Dnm3 G T 1: 162,134,501 F46L probably damaging Het
Dph7 T A 2: 24,963,540 C122* probably null Het
Dspp A T 5: 104,178,039 D756V unknown Het
Ep300 T A 15: 81,641,382 M1469K unknown Het
Fsip2 T C 2: 82,987,939 I4672T possibly damaging Het
Gapdh A T 6: 125,163,033 L67* probably null Het
Gm11639 T C 11: 105,042,902 probably null Het
Gm14025 T C 2: 129,037,690 Q772R probably benign Het
Gm21994 T A 2: 150,255,212 H99L probably damaging Het
Gm3259 G A 5: 95,340,213 S2N probably damaging Het
Gm9495 A T 8: 69,429,314 C337S probably benign Het
Gpr75 A G 11: 30,891,640 R182G probably benign Het
Gsr G T 8: 33,693,807 A366S probably damaging Het
Gypc A G 18: 32,530,195 I33T probably damaging Het
Hapln1 A G 13: 89,608,100 D341G probably benign Het
Hnrnpd A G 5: 99,967,236 S148P probably benign Het
Hydin A T 8: 110,566,620 T3450S probably benign Het
Kif20b T C 19: 34,950,464 V1002A probably benign Het
Kif5c T C 2: 49,735,509 V597A probably benign Het
Kntc1 A G 5: 123,762,516 T226A probably benign Het
Krt75 C A 15: 101,573,723 V37L probably benign Het
L3mbtl2 A G 15: 81,686,942 I668V probably benign Het
Lrp1b G A 2: 41,302,970 A480V probably damaging Het
Lrp1b T A 2: 41,476,809 D485V probably damaging Het
Lrrc37a T C 11: 103,456,596 H3091R unknown Het
Msi1 A G 5: 115,451,491 Y361C probably damaging Het
Mtus1 G T 8: 41,083,040 N546K probably benign Het
Mup17 T A 4: 61,593,699 T113S probably benign Het
Myh11 T A 16: 14,206,074 D1479V probably damaging Het
Ncor1 C T 11: 62,373,161 E198K probably benign Het
Nrde2 A G 12: 100,132,242 V722A probably benign Het
Olfr206 C T 16: 59,345,435 D89N possibly damaging Het
Olfr564 C T 7: 102,804,284 R269* probably null Het
Olfr61 T C 7: 140,638,012 F104L probably benign Het
Otog A G 7: 46,288,950 M2028V probably benign Het
Paox T A 7: 140,131,742 V169E probably damaging Het
Pcsk9 T G 4: 106,456,876 D174A probably benign Het
Pde4b A G 4: 102,570,769 E41G possibly damaging Het
Pip4k2c A G 10: 127,199,074 I419T probably damaging Het
Plekhg3 G T 12: 76,577,941 E1186* probably null Het
Pole C A 5: 110,324,514 P1548T probably benign Het
Pole C T 5: 110,324,515 P1548L probably benign Het
Polq A G 16: 37,061,764 E1430G probably damaging Het
Ptgr2 T C 12: 84,298,146 S98P probably damaging Het
Ralgapa1 A G 12: 55,684,042 Y1903H possibly damaging Het
Rasgrp1 T C 2: 117,291,895 D338G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnase13 C T 14: 51,922,403 C93Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
S100z T A 13: 95,477,426 M59L probably benign Het
Slc16a3 T C 11: 120,957,105 probably null Het
Snd1 T C 6: 28,880,234 V669A probably benign Het
Snrpd3 A T 10: 75,532,195 T49S probably damaging Het
Sort1 T C 3: 108,357,233 L856P possibly damaging Het
Srek1ip1 T A 13: 104,834,322 probably null Het
Ssrp1 T C 2: 85,045,452 S552P probably damaging Het
Stab2 A G 10: 87,003,022 V60A probably benign Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tll1 A C 8: 64,041,491 H743Q possibly damaging Het
Tpo G T 12: 30,094,981 R590S possibly damaging Het
Trbv12-1 A T 6: 41,113,846 T51S probably benign Het
Trbv30 C T 6: 41,281,774 A40V probably benign Het
Tulp4 T A 17: 6,233,215 V1173E possibly damaging Het
Upk1a A T 7: 30,612,385 probably null Het
Vmn1r199 A G 13: 22,382,599 D21G possibly damaging Het
Vmn2r7 T C 3: 64,716,222 T317A probably damaging Het
Wdfy3 A G 5: 101,849,423 V3112A probably damaging Het
Zbtb8os T C 4: 129,340,749 V40A possibly damaging Het
Zwint A G 10: 72,656,853 K108E possibly damaging Het
Other mutations in Ska1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Ska1 APN 18 74196910 missense possibly damaging 0.88
IGL02685:Ska1 APN 18 74197048 missense probably benign 0.00
R0831:Ska1 UTSW 18 74197499 splice site probably benign
R2087:Ska1 UTSW 18 74206849 missense probably benign 0.06
R2232:Ska1 UTSW 18 74197066 splice site probably null
R4658:Ska1 UTSW 18 74197040 missense probably benign 0.01
R5671:Ska1 UTSW 18 74196996 missense probably damaging 1.00
R5876:Ska1 UTSW 18 74197528 missense probably damaging 1.00
R6049:Ska1 UTSW 18 74202600 missense probably benign 0.00
R6885:Ska1 UTSW 18 74206839 missense probably benign 0.41
R7549:Ska1 UTSW 18 74200017 missense probably benign 0.01
R7701:Ska1 UTSW 18 74202643 missense probably damaging 1.00
R7757:Ska1 UTSW 18 74196973 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTACTTTACTGCTCTGGGCT -3'
(R):5'- AAAACATGTTCACTCTGCTACTTCC -3'

Sequencing Primer
(F):5'- ACTAGCTGACTGTGAGCATC -3'
(R):5'- GCTACTTCCCTCTGGCACTTG -3'
Posted On2017-06-26