Incidental Mutation 'R6019:Casz1'
ID478774
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission 044193-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6019 (G1)
Quality Score210.009
Status Validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148947038 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1249 (C1249R)
Ref Sequence ENSEMBL: ENSMUSP00000112978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222]
Predicted Effect probably benign
Transcript: ENSMUST00000094464
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122222
AA Change: C1249R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: C1249R

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123548
Meta Mutation Damage Score 0.8646 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,552,451 H436Y possibly damaging Het
Acad10 A T 5: 121,634,801 H472Q possibly damaging Het
Ano8 G A 8: 71,482,380 R393C probably damaging Het
Arhgap18 T A 10: 26,860,650 V163E probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacng5 T C 11: 107,884,388 M52V probably benign Het
Cenpj C T 14: 56,534,815 S1086N probably benign Het
Chil1 T C 1: 134,189,572 F367S probably benign Het
Copg2 A T 6: 30,810,933 I610N possibly damaging Het
Cpa6 T C 1: 10,595,643 K57E possibly damaging Het
D5Ertd579e C T 5: 36,629,692 A111T possibly damaging Het
Dgat2 A G 7: 99,154,631 M361T probably benign Het
Dnm3 G T 1: 162,134,501 F46L probably damaging Het
Dph7 T A 2: 24,963,540 C122* probably null Het
Dspp A T 5: 104,178,039 D756V unknown Het
Ep300 T A 15: 81,641,382 M1469K unknown Het
Fsip2 T C 2: 82,987,939 I4672T possibly damaging Het
Gapdh A T 6: 125,163,033 L67* probably null Het
Gm11639 T C 11: 105,042,902 probably null Het
Gm14025 T C 2: 129,037,690 Q772R probably benign Het
Gm21994 T A 2: 150,255,212 H99L probably damaging Het
Gm3259 G A 5: 95,340,213 S2N probably damaging Het
Gm9495 A T 8: 69,429,314 C337S probably benign Het
Gpr75 A G 11: 30,891,640 R182G probably benign Het
Gsr G T 8: 33,693,807 A366S probably damaging Het
Gypc A G 18: 32,530,195 I33T probably damaging Het
Hapln1 A G 13: 89,608,100 D341G probably benign Het
Hnrnpd A G 5: 99,967,236 S148P probably benign Het
Hydin A T 8: 110,566,620 T3450S probably benign Het
Kif20b T C 19: 34,950,464 V1002A probably benign Het
Kif5c T C 2: 49,735,509 V597A probably benign Het
Kntc1 A G 5: 123,762,516 T226A probably benign Het
Krt75 C A 15: 101,573,723 V37L probably benign Het
L3mbtl2 A G 15: 81,686,942 I668V probably benign Het
Lrp1b G A 2: 41,302,970 A480V probably damaging Het
Lrp1b T A 2: 41,476,809 D485V probably damaging Het
Lrrc37a T C 11: 103,456,596 H3091R unknown Het
Msi1 A G 5: 115,451,491 Y361C probably damaging Het
Mtus1 G T 8: 41,083,040 N546K probably benign Het
Mup17 T A 4: 61,593,699 T113S probably benign Het
Myh11 T A 16: 14,206,074 D1479V probably damaging Het
Ncor1 C T 11: 62,373,161 E198K probably benign Het
Nrde2 A G 12: 100,132,242 V722A probably benign Het
Olfr206 C T 16: 59,345,435 D89N possibly damaging Het
Olfr564 C T 7: 102,804,284 R269* probably null Het
Olfr61 T C 7: 140,638,012 F104L probably benign Het
Otog A G 7: 46,288,950 M2028V probably benign Het
Paox T A 7: 140,131,742 V169E probably damaging Het
Pcsk9 T G 4: 106,456,876 D174A probably benign Het
Pde4b A G 4: 102,570,769 E41G possibly damaging Het
Pip4k2c A G 10: 127,199,074 I419T probably damaging Het
Plekhg3 G T 12: 76,577,941 E1186* probably null Het
Pole C A 5: 110,324,514 P1548T probably benign Het
Pole C T 5: 110,324,515 P1548L probably benign Het
Polq A G 16: 37,061,764 E1430G probably damaging Het
Ptgr2 T C 12: 84,298,146 S98P probably damaging Het
Ralgapa1 A G 12: 55,684,042 Y1903H possibly damaging Het
Rasgrp1 T C 2: 117,291,895 D338G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnase13 C T 14: 51,922,403 C93Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
S100z T A 13: 95,477,426 M59L probably benign Het
Ska1 T A 18: 74,199,921 D142V probably benign Het
Slc16a3 T C 11: 120,957,105 probably null Het
Snd1 T C 6: 28,880,234 V669A probably benign Het
Snrpd3 A T 10: 75,532,195 T49S probably damaging Het
Sort1 T C 3: 108,357,233 L856P possibly damaging Het
Srek1ip1 T A 13: 104,834,322 probably null Het
Ssrp1 T C 2: 85,045,452 S552P probably damaging Het
Stab2 A G 10: 87,003,022 V60A probably benign Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tll1 A C 8: 64,041,491 H743Q possibly damaging Het
Tpo G T 12: 30,094,981 R590S possibly damaging Het
Trbv12-1 A T 6: 41,113,846 T51S probably benign Het
Trbv30 C T 6: 41,281,774 A40V probably benign Het
Tulp4 T A 17: 6,233,215 V1173E possibly damaging Het
Upk1a A T 7: 30,612,385 probably null Het
Vmn1r199 A G 13: 22,382,599 D21G possibly damaging Het
Vmn2r7 T C 3: 64,716,222 T317A probably damaging Het
Wdfy3 A G 5: 101,849,423 V3112A probably damaging Het
Zbtb8os T C 4: 129,340,749 V40A possibly damaging Het
Zwint A G 10: 72,656,853 K108E possibly damaging Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
R7324:Casz1 UTSW 4 148947033 missense probably damaging 0.99
R7339:Casz1 UTSW 4 148951745 missense probably damaging 1.00
R7388:Casz1 UTSW 4 148952393 missense unknown
R7480:Casz1 UTSW 4 148944586 missense probably damaging 0.99
R7719:Casz1 UTSW 4 148944524 missense probably damaging 0.99
R7789:Casz1 UTSW 4 148929406 missense probably benign
R7801:Casz1 UTSW 4 148938249 missense probably damaging 0.99
R7815:Casz1 UTSW 4 148929305 missense possibly damaging 0.89
R7818:Casz1 UTSW 4 148946076 missense probably damaging 1.00
RF001:Casz1 UTSW 4 148952304 small deletion probably benign
RF063:Casz1 UTSW 4 148952304 small deletion probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTTTCTAACTGGGAGCATGGAAG -3'
(R):5'- GTGATATCGTTCACGGGTCATG -3'

Sequencing Primer
(F):5'- TCTAACTGGGAGCATGGAAGAACAC -3'
(R):5'- ATGGTGGCAGCAGTACCTG -3'
Posted On2017-06-26