Incidental Mutation 'R6012:Ddx23'
ID479831
Institutional Source Beutler Lab
Gene Symbol Ddx23
Ensembl Gene ENSMUSG00000003360
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Synonyms
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6012 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98645134-98662894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98650770 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 352 (D352E)
Ref Sequence ENSEMBL: ENSMUSP00000003450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003450
AA Change: D352E

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003450
Gene: ENSMUSG00000003360
AA Change: D352E

DomainStartEndE-ValueType
coiled coil region 63 93 N/A INTRINSIC
low complexity region 110 130 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 161 200 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
coiled coil region 320 352 N/A INTRINSIC
DEXDc 409 641 2.95e-65 SMART
HELICc 677 758 2.43e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161030
Meta Mutation Damage Score 0.1289 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the U5 snRNP complex; it may facilitate conformational changes in the spliceosome during nuclear pre-mRNA splicing. An alternatively spliced transcript variant has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,582,827 Y97N probably damaging Het
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Glis2 G A 16: 4,611,308 G125D possibly damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hhla1 A C 15: 65,948,490 I137S probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hsd3b2 A T 3: 98,712,017 M204K probably benign Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mfng G A 15: 78,756,640 R302C probably damaging Het
Mogs T A 6: 83,117,382 S393R probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr263 T C 13: 21,132,808 V11A probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Picalm A C 7: 90,195,700 I567L probably benign Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tbc1d15 T C 10: 115,219,207 D310G probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Ddx23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Ddx23 APN 15 98650940 missense probably benign 0.02
IGL02320:Ddx23 APN 15 98650938 missense possibly damaging 0.68
IGL02325:Ddx23 APN 15 98647193 missense possibly damaging 0.80
IGL02456:Ddx23 APN 15 98647549 missense probably damaging 1.00
IGL02514:Ddx23 APN 15 98658318 missense unknown
IGL03173:Ddx23 APN 15 98651004 missense probably benign 0.31
BB007:Ddx23 UTSW 15 98648623 missense probably damaging 1.00
BB017:Ddx23 UTSW 15 98648623 missense probably damaging 1.00
R0077:Ddx23 UTSW 15 98656600 critical splice donor site probably null
R1930:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R1931:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R1932:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R3546:Ddx23 UTSW 15 98650732 missense probably damaging 0.99
R4174:Ddx23 UTSW 15 98658251 missense unknown
R4574:Ddx23 UTSW 15 98647624 missense probably damaging 1.00
R4728:Ddx23 UTSW 15 98650225 missense probably damaging 1.00
R4774:Ddx23 UTSW 15 98647235 missense probably benign 0.00
R4811:Ddx23 UTSW 15 98647471 splice site probably null
R5134:Ddx23 UTSW 15 98650770 missense possibly damaging 0.48
R5895:Ddx23 UTSW 15 98651951 missense probably benign 0.00
R5952:Ddx23 UTSW 15 98658240 missense unknown
R6289:Ddx23 UTSW 15 98649884 missense probably benign 0.05
R6705:Ddx23 UTSW 15 98652968 nonsense probably null
R7289:Ddx23 UTSW 15 98648611 missense probably damaging 0.98
R7484:Ddx23 UTSW 15 98648689 missense probably damaging 0.99
R7543:Ddx23 UTSW 15 98658258 missense unknown
R7740:Ddx23 UTSW 15 98658434 start codon destroyed probably null
R7930:Ddx23 UTSW 15 98648623 missense probably damaging 1.00
R8084:Ddx23 UTSW 15 98658264 missense unknown
Z1088:Ddx23 UTSW 15 98647621 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCCACACTTATCAATGACTTCCAG -3'
(R):5'- TTGACCTAAAGCAGCAGAAGC -3'

Sequencing Primer
(F):5'- TCAATGACTTCCAGGATATGAGG -3'
(R):5'- AGCAGTCACGTTTCTATGGAGACC -3'
Posted On2017-06-26