Incidental Mutation 'R5952:Ddx23'
ID470972
Institutional Source Beutler Lab
Gene Symbol Ddx23
Ensembl Gene ENSMUSG00000003360
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Synonyms
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98645134-98662894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98658240 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 66 (S66T)
Ref Sequence ENSEMBL: ENSMUSP00000125168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003450] [ENSMUST00000162384]
Predicted Effect unknown
Transcript: ENSMUST00000003450
AA Change: S66T
SMART Domains Protein: ENSMUSP00000003450
Gene: ENSMUSG00000003360
AA Change: S66T

DomainStartEndE-ValueType
coiled coil region 63 93 N/A INTRINSIC
low complexity region 110 130 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 161 200 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
coiled coil region 320 352 N/A INTRINSIC
DEXDc 409 641 2.95e-65 SMART
HELICc 677 758 2.43e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161030
Predicted Effect unknown
Transcript: ENSMUST00000162384
AA Change: S66T
SMART Domains Protein: ENSMUSP00000125168
Gene: ENSMUSG00000003360
AA Change: S66T

DomainStartEndE-ValueType
low complexity region 18 80 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228973
Meta Mutation Damage Score 0.0974 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the U5 snRNP complex; it may facilitate conformational changes in the spliceosome during nuclear pre-mRNA splicing. An alternatively spliced transcript variant has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Ddx23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Ddx23 APN 15 98650940 missense probably benign 0.02
IGL02320:Ddx23 APN 15 98650938 missense possibly damaging 0.68
IGL02325:Ddx23 APN 15 98647193 missense possibly damaging 0.80
IGL02456:Ddx23 APN 15 98647549 missense probably damaging 1.00
IGL02514:Ddx23 APN 15 98658318 missense unknown
IGL03173:Ddx23 APN 15 98651004 missense probably benign 0.31
BB007:Ddx23 UTSW 15 98648623 missense probably damaging 1.00
BB017:Ddx23 UTSW 15 98648623 missense probably damaging 1.00
R0077:Ddx23 UTSW 15 98656600 critical splice donor site probably null
R1930:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R1931:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R1932:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R3546:Ddx23 UTSW 15 98650732 missense probably damaging 0.99
R4174:Ddx23 UTSW 15 98658251 missense unknown
R4574:Ddx23 UTSW 15 98647624 missense probably damaging 1.00
R4728:Ddx23 UTSW 15 98650225 missense probably damaging 1.00
R4774:Ddx23 UTSW 15 98647235 missense probably benign 0.00
R4811:Ddx23 UTSW 15 98647471 splice site probably null
R5134:Ddx23 UTSW 15 98650770 missense possibly damaging 0.48
R5895:Ddx23 UTSW 15 98651951 missense probably benign 0.00
R6012:Ddx23 UTSW 15 98650770 missense possibly damaging 0.48
R6289:Ddx23 UTSW 15 98649884 missense probably benign 0.05
R6705:Ddx23 UTSW 15 98652968 nonsense probably null
R7289:Ddx23 UTSW 15 98648611 missense probably damaging 0.98
R7484:Ddx23 UTSW 15 98648689 missense probably damaging 0.99
R7543:Ddx23 UTSW 15 98658258 missense unknown
R7740:Ddx23 UTSW 15 98658434 start codon destroyed probably null
R7930:Ddx23 UTSW 15 98648623 missense probably damaging 1.00
R8084:Ddx23 UTSW 15 98658264 missense unknown
Z1088:Ddx23 UTSW 15 98647621 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TACTCAGCAGCGTATCATGGG -3'
(R):5'- ACGCAATGAGGACCTCTTTCTC -3'

Sequencing Primer
(F):5'- TGGGAAGACCTATGACCACAGC -3'
(R):5'- TTTCTCACCCAGATGGCAGGAG -3'
Posted On2017-03-31