Incidental Mutation 'R6026:Stat5a'
ID480061
Institutional Source Beutler Lab
Gene Symbol Stat5a
Ensembl Gene ENSMUSG00000004043
Gene Namesignal transducer and activator of transcription 5A
SynonymsSTAT5
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6026 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100859351-100885169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100880316 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 574 (F574L)
Ref Sequence ENSEMBL: ENSMUSP00000102979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000103114] [ENSMUST00000107356] [ENSMUST00000107357]
Predicted Effect probably damaging
Transcript: ENSMUST00000004145
AA Change: F574L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043
AA Change: F574L

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103114
SMART Domains Protein: ENSMUSP00000099403
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 7.2e-62 PFAM
Pfam:STAT_bind 321 574 5.7e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107356
AA Change: F574L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043
AA Change: F574L

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107357
AA Change: F574L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043
AA Change: F574L

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 141 330 4.5e-57 PFAM
Pfam:STAT_bind 332 582 1e-104 PFAM
SH2 587 688 1.55e-6 SMART
low complexity region 713 729 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154087
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are reduced in size and display abnormalities in both mammary gland structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Stat5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Stat5a APN 11 100881072 missense probably damaging 1.00
IGL02021:Stat5a APN 11 100883889 missense probably damaging 1.00
IGL02032:Stat5a APN 11 100861828 missense probably damaging 0.99
IGL03108:Stat5a APN 11 100863139 nonsense probably null
IGL03160:Stat5a APN 11 100861845 missense possibly damaging 0.71
hohum UTSW 11 100874129 missense probably damaging 1.00
R8176_stat5a_357 UTSW 11 100876863 missense probably damaging 1.00
yawn UTSW 11 100879693 missense possibly damaging 0.50
R0098:Stat5a UTSW 11 100875626 missense probably damaging 0.98
R0362:Stat5a UTSW 11 100882083 missense probably benign 0.01
R0452:Stat5a UTSW 11 100863135 missense probably benign 0.20
R0520:Stat5a UTSW 11 100861426 missense probably damaging 0.98
R0815:Stat5a UTSW 11 100875082 splice site probably null
R1081:Stat5a UTSW 11 100881060 missense probably damaging 1.00
R1752:Stat5a UTSW 11 100884058 makesense probably null
R1774:Stat5a UTSW 11 100879286 missense probably damaging 1.00
R1868:Stat5a UTSW 11 100874129 missense probably damaging 1.00
R2152:Stat5a UTSW 11 100874090 missense probably benign 0.38
R2900:Stat5a UTSW 11 100874131 missense probably benign 0.18
R4023:Stat5a UTSW 11 100874926 nonsense probably null
R4791:Stat5a UTSW 11 100865463 missense probably damaging 1.00
R5396:Stat5a UTSW 11 100880583 missense probably damaging 1.00
R5641:Stat5a UTSW 11 100876808 missense probably benign 0.01
R5723:Stat5a UTSW 11 100882074 missense probably benign 0.00
R5896:Stat5a UTSW 11 100877057 missense possibly damaging 0.94
R7052:Stat5a UTSW 11 100879285 missense probably damaging 1.00
R7075:Stat5a UTSW 11 100879693 missense possibly damaging 0.50
R7568:Stat5a UTSW 11 100875024 missense possibly damaging 0.74
R7771:Stat5a UTSW 11 100863219 missense probably benign 0.34
R7801:Stat5a UTSW 11 100880317 missense probably damaging 1.00
R7814:Stat5a UTSW 11 100875027 missense probably damaging 1.00
R7856:Stat5a UTSW 11 100883902 missense unknown
R8176:Stat5a UTSW 11 100876863 missense probably damaging 1.00
R8234:Stat5a UTSW 11 100879303 missense possibly damaging 0.59
R8680:Stat5a UTSW 11 100883888 missense unknown
R8923:Stat5a UTSW 11 100880482 missense
Predicted Primers PCR Primer
(F):5'- AGCACAGACAACTCTTCTTAGC -3'
(R):5'- GTTGCTTGTTCACGAAACCC -3'

Sequencing Primer
(F):5'- GGATAGCCCCATGTATAGAAACTTG -3'
(R):5'- GCTTGTTCACGAAACCCAGGATAG -3'
Posted On2017-06-26