Incidental Mutation 'R0452:Stat5a'
ID39709
Institutional Source Beutler Lab
Gene Symbol Stat5a
Ensembl Gene ENSMUSG00000004043
Gene Namesignal transducer and activator of transcription 5A
SynonymsSTAT5
MMRRC Submission 038652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0452 (G1)
Quality Score174
Status Validated
Chromosome11
Chromosomal Location100859351-100885169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100863135 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 97 (T97K)
Ref Sequence ENSEMBL: ENSMUSP00000102980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000107356] [ENSMUST00000107357] [ENSMUST00000133036] [ENSMUST00000138083]
Predicted Effect probably benign
Transcript: ENSMUST00000004145
AA Change: T97K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043
AA Change: T97K

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107356
AA Change: T97K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043
AA Change: T97K

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107357
AA Change: T97K

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043
AA Change: T97K

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 141 330 4.5e-57 PFAM
Pfam:STAT_bind 332 582 1e-104 PFAM
SH2 587 688 1.55e-6 SMART
low complexity region 713 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133036
SMART Domains Protein: ENSMUSP00000117204
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
Pfam:STAT_int 2 51 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138083
AA Change: T97K

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120039
Gene: ENSMUSG00000004043
AA Change: T97K

DomainStartEndE-ValueType
STAT_int 2 125 2.23e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154087
Meta Mutation Damage Score 0.2394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are reduced in size and display abnormalities in both mammary gland structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Elovl5 C T 9: 77,960,911 T35M probably damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lamb2 T C 9: 108,486,354 probably benign Het
Lgals3bp A T 11: 118,393,464 Y430N probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nisch T A 14: 31,177,464 probably benign Het
Nlrp4d G A 7: 10,378,292 T650I probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rasal3 T C 17: 32,395,817 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smarcad1 A T 6: 65,074,822 N313I possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tdrd7 A T 4: 45,965,488 probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Uhmk1 A G 1: 170,212,402 M132T possibly damaging Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Stat5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Stat5a APN 11 100881072 missense probably damaging 1.00
IGL02021:Stat5a APN 11 100883889 missense probably damaging 1.00
IGL02032:Stat5a APN 11 100861828 missense probably damaging 0.99
IGL03108:Stat5a APN 11 100863139 nonsense probably null
IGL03160:Stat5a APN 11 100861845 missense possibly damaging 0.71
hohum UTSW 11 100874129 missense probably damaging 1.00
R8176_stat5a_357 UTSW 11 100876863 missense probably damaging 1.00
yawn UTSW 11 100879693 missense possibly damaging 0.50
R0098:Stat5a UTSW 11 100875626 missense probably damaging 0.98
R0362:Stat5a UTSW 11 100882083 missense probably benign 0.01
R0520:Stat5a UTSW 11 100861426 missense probably damaging 0.98
R0815:Stat5a UTSW 11 100875082 splice site probably null
R1081:Stat5a UTSW 11 100881060 missense probably damaging 1.00
R1752:Stat5a UTSW 11 100884058 makesense probably null
R1774:Stat5a UTSW 11 100879286 missense probably damaging 1.00
R1868:Stat5a UTSW 11 100874129 missense probably damaging 1.00
R2152:Stat5a UTSW 11 100874090 missense probably benign 0.38
R2900:Stat5a UTSW 11 100874131 missense probably benign 0.18
R4023:Stat5a UTSW 11 100874926 nonsense probably null
R4791:Stat5a UTSW 11 100865463 missense probably damaging 1.00
R5396:Stat5a UTSW 11 100880583 missense probably damaging 1.00
R5641:Stat5a UTSW 11 100876808 missense probably benign 0.01
R5723:Stat5a UTSW 11 100882074 missense probably benign 0.00
R5896:Stat5a UTSW 11 100877057 missense possibly damaging 0.94
R6026:Stat5a UTSW 11 100880316 missense probably damaging 1.00
R7052:Stat5a UTSW 11 100879285 missense probably damaging 1.00
R7075:Stat5a UTSW 11 100879693 missense possibly damaging 0.50
R7568:Stat5a UTSW 11 100875024 missense possibly damaging 0.74
R7771:Stat5a UTSW 11 100863219 missense probably benign 0.34
R7801:Stat5a UTSW 11 100880317 missense probably damaging 1.00
R7814:Stat5a UTSW 11 100875027 missense probably damaging 1.00
R7856:Stat5a UTSW 11 100883902 missense unknown
R8176:Stat5a UTSW 11 100876863 missense probably damaging 1.00
R8234:Stat5a UTSW 11 100879303 missense possibly damaging 0.59
R8680:Stat5a UTSW 11 100883888 missense unknown
R8923:Stat5a UTSW 11 100880482 missense
Predicted Primers PCR Primer
(F):5'- AAAGCACCTTGATGCTGGCCTC -3'
(R):5'- ACAGCGTGACATACACTGCCTC -3'

Sequencing Primer
(F):5'- gtctctctgtctctgtctgtc -3'
(R):5'- TGTGCTCTCCATTACATAAACAC -3'
Posted On2013-05-23