Incidental Mutation 'R6000:Arhgap44'
ID480795
Institutional Source Beutler Lab
Gene Symbol Arhgap44
Ensembl Gene ENSMUSG00000033389
Gene NameRho GTPase activating protein 44
SynonymsAU040829
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6000 (G1)
Quality Score217.468
Status Validated
Chromosome11
Chromosomal Location65002039-65162961 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTGCT to CTGCTTGCT at 65032084 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000047463] [ENSMUST00000093002]
Predicted Effect probably null
Transcript: ENSMUST00000047463
SMART Domains Protein: ENSMUSP00000039139
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 530 556 N/A INTRINSIC
low complexity region 561 575 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
low complexity region 664 689 N/A INTRINSIC
low complexity region 695 707 N/A INTRINSIC
low complexity region 716 746 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093002
SMART Domains Protein: ENSMUSP00000090681
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 536 562 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 670 695 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 722 752 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119723
Predicted Effect probably null
Transcript: ENSMUST00000130420
SMART Domains Protein: ENSMUSP00000115612
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
Pfam:BAR 1 117 1.1e-29 PFAM
RhoGAP 141 317 1.07e-66 SMART
low complexity region 411 437 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 545 570 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 597 627 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Ccdc162 C T 10: 41,561,163 C287Y possibly damaging Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dner A T 1: 84,383,929 M653K possibly damaging Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ephb2 A T 4: 136,684,030 S440T possibly damaging Het
Ercc1 A T 7: 19,347,161 probably benign Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gm7298 T C 6: 121,765,079 Y487H possibly damaging Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Hr A G 14: 70,567,833 D1005G probably damaging Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Intu A T 3: 40,654,148 K197* probably null Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1197 C A 2: 88,729,231 A123S probably damaging Het
Olfr1341 A T 4: 118,710,244 N279I probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Arhgap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgap44 APN 11 65041449 missense probably damaging 0.96
IGL01553:Arhgap44 APN 11 65053118 missense probably damaging 1.00
IGL01868:Arhgap44 APN 11 65012078 missense probably damaging 1.00
IGL01996:Arhgap44 APN 11 65005496 utr 3 prime probably benign
IGL02093:Arhgap44 APN 11 65074534 missense probably damaging 1.00
IGL02962:Arhgap44 APN 11 65067161 splice site probably benign
IGL02963:Arhgap44 APN 11 65031663 missense probably damaging 1.00
IGL03032:Arhgap44 APN 11 65024212 missense probably damaging 1.00
R0071:Arhgap44 UTSW 11 65011895 missense possibly damaging 0.90
R0152:Arhgap44 UTSW 11 65011919 missense probably benign 0.13
R0402:Arhgap44 UTSW 11 65032077 splice site probably benign
R1109:Arhgap44 UTSW 11 65026816 missense probably benign 0.00
R1694:Arhgap44 UTSW 11 65053197 missense probably damaging 1.00
R1946:Arhgap44 UTSW 11 65012096 missense probably damaging 0.99
R2036:Arhgap44 UTSW 11 65041492 missense possibly damaging 0.83
R2356:Arhgap44 UTSW 11 65010025 missense probably damaging 1.00
R4342:Arhgap44 UTSW 11 65012061 nonsense probably null
R4657:Arhgap44 UTSW 11 65005452 critical splice donor site probably null
R4763:Arhgap44 UTSW 11 65039165 missense probably damaging 0.98
R4803:Arhgap44 UTSW 11 65053095 missense probably benign 0.00
R5652:Arhgap44 UTSW 11 65024238 missense probably damaging 1.00
R5663:Arhgap44 UTSW 11 65024291 missense probably damaging 1.00
R5833:Arhgap44 UTSW 11 65038677 missense probably damaging 1.00
R6001:Arhgap44 UTSW 11 65032084 frame shift probably null
R6046:Arhgap44 UTSW 11 65032084 frame shift probably null
R6066:Arhgap44 UTSW 11 65032084 frame shift probably null
R6160:Arhgap44 UTSW 11 65162549 unclassified probably benign
R6661:Arhgap44 UTSW 11 65010008 missense probably damaging 0.97
R7062:Arhgap44 UTSW 11 65011932 missense probably benign 0.25
R7388:Arhgap44 UTSW 11 65024268 nonsense probably null
R7793:Arhgap44 UTSW 11 65009924 missense probably damaging 0.99
X0022:Arhgap44 UTSW 11 65053212 missense probably damaging 1.00
X0061:Arhgap44 UTSW 11 65038645 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACATCACCTTGCCATTGG -3'
(R):5'- CGGCATTAGTGAAGTCCTGG -3'

Sequencing Primer
(F):5'- GCCATTGGCTAGCTGTACAG -3'
(R):5'- AGGAGCAGGTAGACTTCCTATTC -3'
Posted On2017-06-26