Incidental Mutation 'R6059:Hnrnph3'
ID483132
Institutional Source Beutler Lab
Gene Symbol Hnrnph3
Ensembl Gene ENSMUSG00000020069
Gene Nameheterogeneous nuclear ribonucleoprotein H3
SynonymshnRNP 2H9, Hnrph3
MMRRC Submission 044225-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R6059 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location63014664-63024217 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 63018862 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020263] [ENSMUST00000118898] [ENSMUST00000119567] [ENSMUST00000119814] [ENSMUST00000140743] [ENSMUST00000143594]
Predicted Effect unknown
Transcript: ENSMUST00000020263
AA Change: M50K
SMART Domains Protein: ENSMUSP00000020263
Gene: ENSMUSG00000020069
AA Change: M50K

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 191 N/A INTRINSIC
RRM 196 266 7.96e-9 SMART
low complexity region 272 286 N/A INTRINSIC
low complexity region 294 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118898
AA Change: M50K
SMART Domains Protein: ENSMUSP00000112424
Gene: ENSMUSG00000020069
AA Change: M50K

DomainStartEndE-ValueType
RRM 17 89 1.11e-7 SMART
low complexity region 102 176 N/A INTRINSIC
RRM 181 251 7.96e-9 SMART
low complexity region 257 271 N/A INTRINSIC
low complexity region 279 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119567
SMART Domains Protein: ENSMUSP00000113429
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 515 N/A INTRINSIC
FYVE 532 599 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119814
SMART Domains Protein: ENSMUSP00000113134
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140743
SMART Domains Protein: ENSMUSP00000118444
Gene: ENSMUSG00000020069

DomainStartEndE-ValueType
PDB:1WG5|A 10 39 3e-11 PDB
Blast:RRM 17 43 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141616
Predicted Effect probably benign
Transcript: ENSMUST00000143594
SMART Domains Protein: ENSMUSP00000115339
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143689
Meta Mutation Damage Score 0.1514 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It is localized in nuclear bodies of the nucleus. This protein is involved in the splicing process and it also participates in early heat shock-induced splicing arrest by transiently leaving the hnRNP complexes. Several alternatively spliced transcript variants have been noted for this gene, however, not all are fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik C A 17: 48,090,327 T44K probably benign Het
4931406P16Rik G A 7: 34,245,463 A452V possibly damaging Het
Ablim2 A G 5: 35,857,164 D189G probably benign Het
Abo A G 2: 26,843,353 V278A possibly damaging Het
Anxa1 A G 19: 20,377,700 F237L possibly damaging Het
Atp11b A G 3: 35,814,177 Y466C possibly damaging Het
Cfh T A 1: 140,118,690 K531N possibly damaging Het
Cgref1 G T 5: 30,945,384 P31Q probably damaging Het
Clca3a2 G A 3: 144,810,770 A355V probably damaging Het
Cntnap5c T A 17: 58,313,712 C929S probably damaging Het
Col6a6 A T 9: 105,783,917 V331D probably damaging Het
Cyp4a12b T A 4: 115,438,104 V469E possibly damaging Het
Dchs2 A G 3: 83,355,736 S3104G probably benign Het
Ddx24 G T 12: 103,408,300 A875E probably damaging Het
Dsc1 A T 18: 20,110,242 N51K probably damaging Het
Epb41l3 A G 17: 69,284,642 E708G probably damaging Het
Epb41l3 C T 17: 69,286,798 T537I probably damaging Het
Fam162b A T 10: 51,590,307 C39S probably benign Het
Gbf1 T C 19: 46,265,248 I531T probably damaging Het
Glipr1l2 T C 10: 112,083,518 V48A probably benign Het
Gm11639 T C 11: 105,036,769 I4788T probably benign Het
Gm13023 T G 4: 143,793,980 S101A possibly damaging Het
Gorasp1 A G 9: 119,930,006 V177A probably damaging Het
Gys1 A G 7: 45,455,288 probably null Het
Hif1a T A 12: 73,941,800 V523E probably damaging Het
Lcn9 C A 2: 25,824,725 L159I possibly damaging Het
Luzp1 C T 4: 136,541,480 A338V probably benign Het
Map3k10 A T 7: 27,656,822 S891T probably damaging Het
Mmrn2 C T 14: 34,397,591 Q97* probably null Het
Mov10 G A 3: 104,817,950 probably benign Het
Ncam1 A C 9: 49,544,666 Y551D probably damaging Het
Ncf1 A T 5: 134,223,487 Y237N probably damaging Het
Nipbl A T 15: 8,295,568 I2537N probably damaging Het
Nlrp1b A T 11: 71,217,010 V555E possibly damaging Het
Nod2 T C 8: 88,664,414 Y428H probably damaging Het
Nup133 C A 8: 123,914,596 A862S probably damaging Het
Pcdhgb2 T A 18: 37,690,025 L23* probably null Het
Pclo A G 5: 14,811,700 E4889G unknown Het
Plcd3 T A 11: 103,080,401 I110F possibly damaging Het
Plxna2 C A 1: 194,810,971 N1851K possibly damaging Het
Ppp2r5c C A 12: 110,574,788 A457E probably benign Het
Ppp5c C T 7: 17,027,907 probably benign Het
Prg4 T A 1: 150,449,997 Y1009F possibly damaging Het
Rcor3 A T 1: 192,119,940 M303K probably benign Het
Rrn3 G A 16: 13,806,604 M433I probably benign Het
Serpinb9e G A 13: 33,257,774 V230M probably benign Het
Shisa6 T A 11: 66,224,974 H279L probably damaging Het
Slc38a11 A T 2: 65,334,745 I234N probably damaging Het
Socs1 G C 16: 10,784,530 F114L probably damaging Het
Ssc5d C T 7: 4,942,744 T925M possibly damaging Het
Stc1 T C 14: 69,032,438 S156P probably damaging Het
Ttc5 C G 14: 50,777,846 V103L probably damaging Het
Vmn1r73 A G 7: 11,756,611 T119A probably benign Het
Vmn2r99 G A 17: 19,378,980 D309N probably benign Het
Vps53 T C 11: 76,066,867 H353R possibly damaging Het
Ythdf3 T A 3: 16,203,192 Y47* probably null Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Other mutations in Hnrnph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hnrnph3 APN 10 63018124 makesense probably null
IGL02112:Hnrnph3 APN 10 63016405 critical splice donor site probably null
IGL02116:Hnrnph3 APN 10 63016076 intron probably benign
IGL02193:Hnrnph3 APN 10 63017277 missense probably damaging 0.98
IGL02211:Hnrnph3 APN 10 63017342 unclassified probably benign
IGL02410:Hnrnph3 APN 10 63015724 intron probably benign
IGL02616:Hnrnph3 APN 10 63019485 missense possibly damaging 0.66
IGL03033:Hnrnph3 APN 10 63018179 missense probably benign 0.00
IGL03367:Hnrnph3 APN 10 63017229 missense probably damaging 1.00
R0450:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0450:Hnrnph3 UTSW 10 63019500 missense probably damaging 0.99
R0469:Hnrnph3 UTSW 10 63018215 missense probably benign 0.01
R0469:Hnrnph3 UTSW 10 63019500 missense probably damaging 0.99
R1585:Hnrnph3 UTSW 10 63015800 critical splice donor site probably null
R4285:Hnrnph3 UTSW 10 63016468 missense probably damaging 1.00
R4706:Hnrnph3 UTSW 10 63017280 missense probably damaging 1.00
R5606:Hnrnph3 UTSW 10 63019443 missense possibly damaging 0.94
R5873:Hnrnph3 UTSW 10 63019391 critical splice donor site probably null
R5952:Hnrnph3 UTSW 10 63015595 intron probably benign
R6644:Hnrnph3 UTSW 10 63018893 unclassified probably benign
R7517:Hnrnph3 UTSW 10 63018895 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCTTACCCACCCCATTTAAG -3'
(R):5'- TGAGTTACCATTGGGAGCACAG -3'

Sequencing Primer
(F):5'- CACCCCATTTAAGCAACAGTG -3'
(R):5'- GTTACCATTGGGAGCACAGTTAATG -3'
Posted On2017-07-14