Incidental Mutation 'R6106:Olfr883'
ID485512
Institutional Source Beutler Lab
Gene Symbol Olfr883
Ensembl Gene ENSMUSG00000094461
Gene Nameolfactory receptor 883
SynonymsGA_x6K02T2PVTD-31705144-31706073, MOR162-6
MMRRC Submission 044256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R6106 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38025808-38026737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38026466 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 220 (I220N)
Ref Sequence ENSEMBL: ENSMUSP00000072741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072974]
Predicted Effect probably damaging
Transcript: ENSMUST00000072974
AA Change: I220N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072741
Gene: ENSMUSG00000094461
AA Change: I220N

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.6e-48 PFAM
Pfam:7tm_1 41 288 3.7e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,613,412 T1105A possibly damaging Het
Ace A G 11: 105,989,012 E726G probably damaging Het
Adgrl4 A G 3: 151,540,985 I641V possibly damaging Het
Apoa5 A T 9: 46,270,633 R336* probably null Het
Bfsp2 T A 9: 103,479,824 T135S probably benign Het
Calhm2 A T 19: 47,133,062 Y223N probably damaging Het
Ccdc158 T C 5: 92,627,466 E960G probably benign Het
Ccdc80 T C 16: 45,096,710 S610P probably benign Het
Cdon T A 9: 35,455,408 Y193* probably null Het
Cept1 A T 3: 106,503,676 H400Q probably benign Het
Clspn T A 4: 126,590,641 N1197K probably benign Het
Cnot8 T C 11: 58,113,990 S172P probably damaging Het
Col14a1 T C 15: 55,520,008 I1794T probably damaging Het
Fam183b T C 11: 58,796,601 E66G probably damaging Het
Fam193a A T 5: 34,459,030 T564S possibly damaging Het
Galnt1 G A 18: 24,254,663 V154I probably benign Het
Gm14139 A G 2: 150,192,805 K349E probably damaging Het
Gstcd C A 3: 132,998,914 E526D probably benign Het
Ighv1-42 A C 12: 114,937,287 S59R probably benign Het
Morn3 A G 5: 123,046,760 C6R possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr169 A G 16: 19,566,259 L208P probably damaging Het
Olfr632 A G 7: 103,938,193 H271R probably benign Het
Olfr913 T C 9: 38,594,956 M245T probably benign Het
Pcdhb11 A G 18: 37,423,003 N462S probably damaging Het
Pfpl G T 19: 12,429,461 D359Y probably damaging Het
Phyhip T C 14: 70,461,859 V34A probably benign Het
Pigu A T 2: 155,297,196 I313N possibly damaging Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Psg16 T A 7: 17,095,166 F225Y possibly damaging Het
Setdb2 T A 14: 59,423,449 K82* probably null Het
Sgms1 A G 19: 32,124,425 S394P possibly damaging Het
Slc16a1 T C 3: 104,652,994 L205P probably benign Het
Slc19a1 T A 10: 77,044,769 I380N probably damaging Het
Snx32 A G 19: 5,498,014 I131T probably benign Het
Sorbs3 T C 14: 70,192,604 probably null Het
Stc2 T A 11: 31,360,392 I215L probably benign Het
Tln2 C T 9: 67,323,020 A84T probably damaging Het
Tomm34 A G 2: 164,060,991 M133T probably benign Het
Usp43 A G 11: 67,879,907 S634P probably benign Het
Vmn2r59 T A 7: 42,012,325 R689* probably null Het
Vmn2r9 C T 5: 108,845,036 R536Q probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfhx2 T A 14: 55,068,310 probably null Het
Zfp608 G T 18: 54,987,872 H214Q possibly damaging Het
Zfp619 T C 7: 39,535,134 V196A probably benign Het
Other mutations in Olfr883
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Olfr883 APN 9 38025811 missense probably benign 0.02
IGL02092:Olfr883 APN 9 38026621 missense possibly damaging 0.80
IGL02351:Olfr883 APN 9 38026036 missense possibly damaging 0.78
IGL02358:Olfr883 APN 9 38026036 missense possibly damaging 0.78
IGL02807:Olfr883 APN 9 38026189 missense probably damaging 1.00
R0972:Olfr883 UTSW 9 38026560 missense possibly damaging 0.88
R1016:Olfr883 UTSW 9 38026691 missense probably damaging 0.98
R1818:Olfr883 UTSW 9 38026507 missense probably damaging 1.00
R4466:Olfr883 UTSW 9 38026183 missense probably damaging 0.99
R4871:Olfr883 UTSW 9 38026526 missense probably damaging 1.00
R5977:Olfr883 UTSW 9 38026540 frame shift probably null
R5979:Olfr883 UTSW 9 38026540 frame shift probably null
R6026:Olfr883 UTSW 9 38026540 frame shift probably null
R6027:Olfr883 UTSW 9 38026540 frame shift probably null
R6029:Olfr883 UTSW 9 38026540 frame shift probably null
R6035:Olfr883 UTSW 9 38026540 frame shift probably null
R6035:Olfr883 UTSW 9 38026540 frame shift probably null
R6053:Olfr883 UTSW 9 38026541 frame shift probably null
R6092:Olfr883 UTSW 9 38026540 frame shift probably null
R6131:Olfr883 UTSW 9 38026540 frame shift probably null
R6132:Olfr883 UTSW 9 38026540 frame shift probably null
R6133:Olfr883 UTSW 9 38026540 frame shift probably null
R6134:Olfr883 UTSW 9 38026540 frame shift probably null
R6153:Olfr883 UTSW 9 38026540 frame shift probably null
R6251:Olfr883 UTSW 9 38026537 frame shift probably null
R6251:Olfr883 UTSW 9 38026545 frame shift probably null
R6251:Olfr883 UTSW 9 38026546 frame shift probably null
R6251:Olfr883 UTSW 9 38026548 frame shift probably null
R6300:Olfr883 UTSW 9 38026540 frame shift probably null
R6301:Olfr883 UTSW 9 38026540 frame shift probably null
R6305:Olfr883 UTSW 9 38026540 frame shift probably null
R6305:Olfr883 UTSW 9 38026542 frame shift probably null
R6307:Olfr883 UTSW 9 38026540 frame shift probably null
R6312:Olfr883 UTSW 9 38026540 frame shift probably null
R6312:Olfr883 UTSW 9 38026541 frame shift probably null
R6312:Olfr883 UTSW 9 38026546 frame shift probably null
R6312:Olfr883 UTSW 9 38026547 nonsense probably null
R6312:Olfr883 UTSW 9 38026549 frame shift probably null
R6813:Olfr883 UTSW 9 38025833 missense probably damaging 1.00
R7134:Olfr883 UTSW 9 38026499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAAGCCATTGCACACAC -3'
(R):5'- AAAGGATTCAGCATTGGGCC -3'

Sequencing Primer
(F):5'- CCATTGCACACACTGGTAGTATGG -3'
(R):5'- TTGGGCCCACAATGGTATAAAAG -3'
Posted On2017-08-16