Incidental Mutation 'R1016:Or8b36'
ID 96328
Institutional Source Beutler Lab
Gene Symbol Or8b36
Ensembl Gene ENSMUSG00000094461
Gene Name olfactory receptor family 8 subfamily B member 36
Synonyms MOR162-6, Olfr883, GA_x6K02T2PVTD-31705144-31706073
MMRRC Submission 039120-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R1016 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 37937104-37938033 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37937987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 295 (V295A)
Ref Sequence ENSEMBL: ENSMUSP00000072741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072974]
AlphaFold Q8VF64
Predicted Effect probably damaging
Transcript: ENSMUST00000072974
AA Change: V295A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072741
Gene: ENSMUSG00000094461
AA Change: V295A

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.6e-48 PFAM
Pfam:7tm_1 41 288 3.7e-24 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,710,227 (GRCm39) H6Q probably null Het
Clstn1 T C 4: 149,731,286 (GRCm39) I866T probably benign Het
Cntnap1 T C 11: 101,068,333 (GRCm39) V86A probably damaging Het
Crtc1 A T 8: 70,844,769 (GRCm39) Y351* probably null Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Cyp2j12 C T 4: 96,001,102 (GRCm39) probably null Het
Dmrt2 A T 19: 25,652,938 (GRCm39) K183N probably damaging Het
Fancl G T 11: 26,337,195 (GRCm39) probably benign Het
Fbxo40 G A 16: 36,789,539 (GRCm39) Q524* probably null Het
Flcn T C 11: 59,686,691 (GRCm39) probably null Het
Gm19965 T A 1: 116,749,031 (GRCm39) C237* probably null Het
Hpf1 A G 8: 61,348,678 (GRCm39) Y131C possibly damaging Het
Mdh1 A G 11: 21,509,769 (GRCm39) L202P probably benign Het
Mpl T C 4: 118,306,110 (GRCm39) Y310C probably damaging Het
Mtus1 A G 8: 41,503,063 (GRCm39) V784A probably benign Het
Myg1 T C 15: 102,242,786 (GRCm39) I159T possibly damaging Het
Nans T C 4: 46,500,716 (GRCm39) Y203H probably benign Het
Ncapg2 G A 12: 116,402,295 (GRCm39) C709Y probably damaging Het
Parp12 T C 6: 39,088,660 (GRCm39) Y192C probably damaging Het
Plekha6 A G 1: 133,187,832 (GRCm39) N118D probably benign Het
Prg4 T C 1: 150,330,442 (GRCm39) probably benign Het
Psip1 T C 4: 83,378,135 (GRCm39) T454A possibly damaging Het
Ptprz1 T C 6: 23,000,973 (GRCm39) L1021P probably damaging Het
Pvr T C 7: 19,643,142 (GRCm39) I364V probably benign Het
Serpina5 A G 12: 104,071,582 (GRCm39) I396M probably damaging Het
Sgcb A C 5: 73,797,183 (GRCm39) H192Q probably benign Het
Slc4a9 C A 18: 36,664,478 (GRCm39) H379N probably benign Het
Tet1 T C 10: 62,715,729 (GRCm39) D22G probably benign Het
Trim34a T C 7: 103,897,167 (GRCm39) V77A probably benign Het
Ttc7b T C 12: 100,369,617 (GRCm39) E384G probably null Het
Vmn2r16 G A 5: 109,487,754 (GRCm39) G209D probably damaging Het
Other mutations in Or8b36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Or8b36 APN 9 37,937,107 (GRCm39) missense probably benign 0.02
IGL02092:Or8b36 APN 9 37,937,917 (GRCm39) missense possibly damaging 0.80
IGL02351:Or8b36 APN 9 37,937,332 (GRCm39) missense possibly damaging 0.78
IGL02358:Or8b36 APN 9 37,937,332 (GRCm39) missense possibly damaging 0.78
IGL02807:Or8b36 APN 9 37,937,485 (GRCm39) missense probably damaging 1.00
R0972:Or8b36 UTSW 9 37,937,856 (GRCm39) missense possibly damaging 0.88
R1818:Or8b36 UTSW 9 37,937,803 (GRCm39) missense probably damaging 1.00
R4466:Or8b36 UTSW 9 37,937,479 (GRCm39) missense probably damaging 0.99
R4871:Or8b36 UTSW 9 37,937,822 (GRCm39) missense probably damaging 1.00
R5977:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R5979:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6026:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6027:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6029:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6035:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6035:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6053:Or8b36 UTSW 9 37,937,837 (GRCm39) frame shift probably null
R6092:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6106:Or8b36 UTSW 9 37,937,762 (GRCm39) missense probably damaging 1.00
R6131:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6132:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6133:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6134:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6153:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6251:Or8b36 UTSW 9 37,937,842 (GRCm39) frame shift probably null
R6251:Or8b36 UTSW 9 37,937,841 (GRCm39) frame shift probably null
R6251:Or8b36 UTSW 9 37,937,833 (GRCm39) frame shift probably null
R6251:Or8b36 UTSW 9 37,937,844 (GRCm39) frame shift probably null
R6300:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6301:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6305:Or8b36 UTSW 9 37,937,838 (GRCm39) frame shift probably null
R6305:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6307:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,842 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,837 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,836 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,845 (GRCm39) frame shift probably null
R6312:Or8b36 UTSW 9 37,937,843 (GRCm39) nonsense probably null
R6813:Or8b36 UTSW 9 37,937,129 (GRCm39) missense probably damaging 1.00
R7134:Or8b36 UTSW 9 37,937,795 (GRCm39) missense probably benign 0.00
R7775:Or8b36 UTSW 9 37,937,963 (GRCm39) missense probably damaging 1.00
R7778:Or8b36 UTSW 9 37,937,963 (GRCm39) missense probably damaging 1.00
R7984:Or8b36 UTSW 9 37,937,155 (GRCm39) missense probably damaging 1.00
R8326:Or8b36 UTSW 9 37,938,014 (GRCm39) missense probably benign 0.00
R9154:Or8b36 UTSW 9 37,937,690 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCCCATGTGATTGCTGTTTCACT -3'
(R):5'- TCAGGATTTCCAAAGAGAAAGGCTACCT -3'

Sequencing Primer
(F):5'- GTTTCACTTTTCTTTGGAGCTGC -3'
(R):5'- ttcccccacccacccac -3'
Posted On 2014-01-05