Incidental Mutation 'R6182:Gpc2'
ID487019
Institutional Source Beutler Lab
Gene Symbol Gpc2
Ensembl Gene ENSMUSG00000029510
Gene Nameglypican 2 (cerebroglycan)
Synonyms
MMRRC Submission 044324-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6182 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location138273655-138280005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138278414 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 150 (D150G)
Ref Sequence ENSEMBL: ENSMUSP00000137879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014089] [ENSMUST00000048028] [ENSMUST00000159067] [ENSMUST00000160729] [ENSMUST00000161691] [ENSMUST00000161827] [ENSMUST00000161984] [ENSMUST00000162245]
Predicted Effect probably benign
Transcript: ENSMUST00000014089
AA Change: D150G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000014089
Gene: ENSMUSG00000029510
AA Change: D150G

DomainStartEndE-ValueType
Pfam:Glypican 7 560 2.8e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048028
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159067
AA Change: D150G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247
AA Change: D150G

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159689
Predicted Effect probably benign
Transcript: ENSMUST00000160729
SMART Domains Protein: ENSMUSP00000124170
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect probably benign
Transcript: ENSMUST00000161691
SMART Domains Protein: ENSMUSP00000125290
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161827
AA Change: D150G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000124459
Gene: ENSMUSG00000029510
AA Change: D150G

DomainStartEndE-ValueType
Pfam:Glypican 11 566 3.1e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161984
AA Change: D150G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000137879
Gene: ENSMUSG00000029510
AA Change: D150G

DomainStartEndE-ValueType
Pfam:Glypican 7 342 3.7e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162909
Predicted Effect probably benign
Transcript: ENSMUST00000162245
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 T C 9: 90,192,436 S884P probably benign Het
Akap13 C A 7: 75,586,280 A201E probably benign Het
Ccdc151 A G 9: 21,990,402 F553S probably damaging Het
Ces1f T G 8: 93,256,496 E540A probably benign Het
Chid1 T A 7: 141,528,502 M137L probably benign Het
Chsy3 A G 18: 59,179,342 T296A probably benign Het
Clec4f A G 6: 83,645,302 V519A probably benign Het
Clk4 T A 11: 51,268,182 F41I possibly damaging Het
Cntnap5c A G 17: 57,876,395 D32G probably benign Het
Ctsl T C 13: 64,367,972 Y95C probably damaging Het
Cyp2c54 T C 19: 40,047,561 M302V probably benign Het
Cyp2c65 C G 19: 39,061,162 L45V probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam1 C T 12: 71,959,887 Q693* probably null Het
Dgcr8 A T 16: 18,280,308 D406E probably benign Het
Dock2 G T 11: 34,229,476 P1760Q probably damaging Het
Epb41l2 G A 10: 25,507,817 R940H probably damaging Het
Erc2 A C 14: 28,317,253 D951A probably damaging Het
Fbxw7 T C 3: 84,815,771 probably null Het
Frem2 T A 3: 53,647,969 I1716F probably damaging Het
Fus A G 7: 127,977,293 D295G probably damaging Het
Gm5093 A G 17: 46,439,642 I153T probably benign Het
Gnptab T C 10: 88,429,480 V318A possibly damaging Het
Gsc2 A G 16: 17,913,619 *215R probably null Het
Hectd3 T C 4: 117,000,279 S552P probably damaging Het
Katnal1 C A 5: 148,904,597 K152N possibly damaging Het
Kcnh1 A T 1: 192,191,053 T16S probably damaging Het
Lrrc71 T C 3: 87,745,794 D105G probably benign Het
Mon2 T C 10: 123,038,659 probably null Het
Mpp6 A G 6: 50,198,226 I506V probably benign Het
Mroh9 G A 1: 163,066,043 Q188* probably null Het
Mtmr14 A G 6: 113,269,508 S81G possibly damaging Het
Nrap T A 19: 56,361,698 M628L probably benign Het
Olfr107 T A 17: 37,405,992 I148K possibly damaging Het
Olfr173 A G 16: 58,797,292 Y185H probably damaging Het
Pate4 A T 9: 35,608,290 S35T possibly damaging Het
Pkd1l1 T C 11: 8,865,555 E1452G probably benign Het
Pld5 T C 1: 176,044,854 D239G probably benign Het
Ppef2 C T 5: 92,227,066 V728M probably damaging Het
Rasip1 TGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGC 7: 45,628,455 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina3c C A 12: 104,149,431 V285L probably benign Het
Serpinb9f T C 13: 33,334,422 S302P probably damaging Het
Sis C T 3: 72,904,293 V1642I probably benign Het
Slc12a4 G A 8: 105,947,899 L601F probably damaging Het
Slc39a6 G T 18: 24,600,956 N225K probably benign Het
Snrnp70 G A 7: 45,377,073 R291* probably null Het
Spin1 C T 13: 51,144,338 T131I probably benign Het
St18 T G 1: 6,844,118 probably null Het
Stox1 A G 10: 62,664,942 L613P probably damaging Het
Tgm3 T G 2: 130,025,301 Y155* probably null Het
Tmem67 T C 4: 12,051,402 I809V probably benign Het
Tnc T A 4: 64,008,796 D831V probably damaging Het
Ttll13 A T 7: 80,260,233 E762D probably benign Het
Unc5b A T 10: 60,765,236 V937E probably damaging Het
Vmn1r34 A G 6: 66,637,328 I142T probably damaging Het
Vmn2r104 A G 17: 20,030,245 M588T probably benign Het
Vmn2r77 T C 7: 86,811,749 V761A probably damaging Het
Wdr48 G T 9: 119,924,766 G665W probably damaging Het
Xpot T A 10: 121,606,258 R550S probably damaging Het
Ydjc A G 16: 17,147,079 T33A probably benign Het
Zfc3h1 A G 10: 115,390,859 T274A probably benign Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp788 T A 7: 41,650,516 C859S probably damaging Het
Zscan4c T C 7: 11,006,782 M76T probably benign Het
Other mutations in Gpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Gpc2 APN 5 138274309 utr 3 prime probably benign
IGL00938:Gpc2 APN 5 138278907 missense probably benign 0.08
IGL01315:Gpc2 APN 5 138276039 missense probably benign 0.00
IGL01583:Gpc2 APN 5 138275530 missense probably damaging 1.00
IGL01590:Gpc2 APN 5 138274378 missense probably damaging 0.99
IGL02040:Gpc2 APN 5 138276582 critical splice donor site probably null
IGL02322:Gpc2 APN 5 138276237 splice site probably null
IGL02655:Gpc2 APN 5 138278925 missense possibly damaging 0.73
R0638:Gpc2 UTSW 5 138278534 missense possibly damaging 0.79
R1004:Gpc2 UTSW 5 138278225 missense probably damaging 1.00
R1918:Gpc2 UTSW 5 138278379 missense probably benign 0.01
R4177:Gpc2 UTSW 5 138277359 unclassified probably benign
R4361:Gpc2 UTSW 5 138278290 nonsense probably null
R5178:Gpc2 UTSW 5 138275605 missense possibly damaging 0.59
R5250:Gpc2 UTSW 5 138278968 missense probably damaging 1.00
R5365:Gpc2 UTSW 5 138275623 missense probably damaging 1.00
R6548:Gpc2 UTSW 5 138277271 splice site probably null
R6985:Gpc2 UTSW 5 138278408 missense probably damaging 1.00
R7064:Gpc2 UTSW 5 138278910 missense probably damaging 1.00
R7821:Gpc2 UTSW 5 138276297 missense probably benign 0.43
R8460:Gpc2 UTSW 5 138276629 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGTTCAGGTTGTGGGACC -3'
(R):5'- CCTAGTCTGCCAGCTTACTCAG -3'

Sequencing Primer
(F):5'- TGTGGGACCTCCTCACCTGTAG -3'
(R):5'- GCTTACTCAGCTTCTAATTCTTTTGC -3'
Posted On2017-10-10