Incidental Mutation 'R6136:Nop53'
ID488348
Institutional Source Beutler Lab
Gene Symbol Nop53
Ensembl Gene ENSMUSG00000041560
Gene NameNOP53 ribosome biogenesis factor
SynonymsGltscr2, 9430097C02Rik
MMRRC Submission 044283-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6136 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location15936183-15946074 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 15938389 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 452 (Q452*)
Ref Sequence ENSEMBL: ENSMUSP00000043981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044158]
Predicted Effect probably null
Transcript: ENSMUST00000044158
AA Change: Q452*
SMART Domains Protein: ENSMUSP00000043981
Gene: ENSMUSG00000041560
AA Change: Q452*

DomainStartEndE-ValueType
Pfam:Nop53 41 451 6e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198688
SMART Domains Protein: ENSMUSP00000143400
Gene: ENSMUSG00000041560

DomainStartEndE-ValueType
Pfam:Nop53 1 156 1.4e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200455
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygous knockout is pre-implantation embryonic lethal. Heterozygous knockout reduces incidence of chemically induced skin papilloma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,853 S729P probably damaging Het
3100002H09Rik C A 4: 124,610,388 G124C unknown Het
3425401B19Rik A T 14: 32,662,282 D575E possibly damaging Het
Abca15 A T 7: 120,340,049 H222L possibly damaging Het
Arhgef18 T C 8: 3,454,507 V1013A probably benign Het
Arsj T C 3: 126,364,775 M1T probably null Het
Atp10a A C 7: 58,828,340 Q1377P probably benign Het
Atrip T A 9: 109,071,736 E178D probably damaging Het
Chadl T C 15: 81,693,554 N625D probably benign Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Cox11 T C 11: 90,644,395 L84P probably damaging Het
Dchs1 T G 7: 105,760,925 T1747P probably benign Het
Dnah12 A G 14: 26,875,270 K3529E probably damaging Het
Ecd T C 14: 20,320,791 N620S probably damaging Het
Fbn1 T A 2: 125,403,132 K278N possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fzd7 T G 1: 59,483,260 F101V probably damaging Het
Galnt13 G T 2: 54,516,479 probably benign Het
Gif G A 19: 11,750,285 A158T probably damaging Het
Gm32647 C T 7: 94,475,732 Het
Gm5624 A T 14: 44,559,876 D152E probably benign Het
Heatr6 T A 11: 83,772,503 V664E possibly damaging Het
Hpgd A G 8: 56,294,952 D36G probably damaging Het
Ifnlr1 A G 4: 135,703,797 T199A possibly damaging Het
Kalrn T G 16: 34,357,111 D228A probably damaging Het
Miox T C 15: 89,335,321 M47T probably damaging Het
Nampt A T 12: 32,830,302 I65F probably benign Het
Ncf1 T C 5: 134,226,633 K135E probably damaging Het
Olfr1037 A G 2: 86,084,901 L292S probably damaging Het
Pik3cg A G 12: 32,204,359 V543A probably benign Het
Ralgds T C 2: 28,550,565 probably null Het
Rap1a A G 3: 105,750,282 V7A probably damaging Het
Rasal1 T C 5: 120,675,478 V639A possibly damaging Het
Rassf8 A G 6: 145,815,656 N236S probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sbno1 T C 5: 124,378,491 D1272G probably benign Het
Setx A G 2: 29,148,027 D1508G probably benign Het
Slc1a1 T A 19: 28,905,410 L358Q probably damaging Het
Slc7a12 C A 3: 14,499,126 L20I probably benign Het
Spats2l C T 1: 57,902,143 T187M probably damaging Het
Specc1l A G 10: 75,246,660 D647G probably benign Het
Steap4 G A 5: 7,978,562 R380Q probably damaging Het
Syne2 A G 12: 75,905,325 S456G probably benign Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tns2 T A 15: 102,107,030 D122E probably damaging Het
Tshr A G 12: 91,538,234 M649V probably benign Het
Ubr3 A G 2: 69,993,763 T1440A probably benign Het
Urb2 A G 8: 124,030,092 D846G probably benign Het
Vmn1r202 T C 13: 22,501,462 T262A possibly damaging Het
Vmn2r61 G T 7: 42,267,031 W356L probably damaging Het
Wdr11 T A 7: 129,618,703 M605K possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Nop53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Nop53 APN 7 15940157 missense probably damaging 1.00
IGL01558:Nop53 APN 7 15945826 unclassified probably benign
IGL02519:Nop53 APN 7 15939272 splice site probably benign
levophed UTSW 7 15945854 missense possibly damaging 0.91
R0315:Nop53 UTSW 7 15945310 missense probably damaging 1.00
R1614:Nop53 UTSW 7 15945965 missense probably benign 0.04
R2004:Nop53 UTSW 7 15938228 missense probably damaging 1.00
R4169:Nop53 UTSW 7 15942319 missense probably benign 0.01
R4760:Nop53 UTSW 7 15942887 missense probably benign 0.07
R4788:Nop53 UTSW 7 15942315 missense possibly damaging 0.82
R4830:Nop53 UTSW 7 15942204 missense probably damaging 0.97
R5734:Nop53 UTSW 7 15945962 unclassified probably null
R6688:Nop53 UTSW 7 15945854 missense possibly damaging 0.91
R6946:Nop53 UTSW 7 15938358 missense probably damaging 0.99
R7384:Nop53 UTSW 7 15939495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAATCTCACGGTAGGCC -3'
(R):5'- CATTGACTTCAGTATAGAGCCCC -3'

Sequencing Primer
(F):5'- ACCAGCTTCACTTTGTATTTGCG -3'
(R):5'- ACTTCAGTATAGAGCCCCCTGGAG -3'
Posted On2017-10-10