Incidental Mutation 'R6136:Rasal1'
ID488344
Institutional Source Beutler Lab
Gene Symbol Rasal1
Ensembl Gene ENSMUSG00000029602
Gene NameRAS protein activator like 1 (GAP1 like)
SynonymsMRASAL
MMRRC Submission 044283-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6136 (G1)
Quality Score132.008
Status Validated
Chromosome5
Chromosomal Location120648812-120679597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120675478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 639 (V639A)
Ref Sequence ENSEMBL: ENSMUSP00000123266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000031607] [ENSMUST00000156722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031606
AA Change: V639A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: V639A

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031607
SMART Domains Protein: ENSMUSP00000031607
Gene: ENSMUSG00000029603

DomainStartEndE-ValueType
WWE 23 102 1.29e-38 SMART
WWE 104 179 3.88e-33 SMART
low complexity region 226 251 N/A INTRINSIC
low complexity region 258 290 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RING 418 478 5.82e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154759
Predicted Effect possibly damaging
Transcript: ENSMUST00000156722
AA Change: V639A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: V639A

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201264
Meta Mutation Damage Score 0.2182 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,853 S729P probably damaging Het
3100002H09Rik C A 4: 124,610,388 G124C unknown Het
3425401B19Rik A T 14: 32,662,282 D575E possibly damaging Het
Abca15 A T 7: 120,340,049 H222L possibly damaging Het
Arhgef18 T C 8: 3,454,507 V1013A probably benign Het
Arsj T C 3: 126,364,775 M1T probably null Het
Atp10a A C 7: 58,828,340 Q1377P probably benign Het
Atrip T A 9: 109,071,736 E178D probably damaging Het
Chadl T C 15: 81,693,554 N625D probably benign Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Cox11 T C 11: 90,644,395 L84P probably damaging Het
Dchs1 T G 7: 105,760,925 T1747P probably benign Het
Dnah12 A G 14: 26,875,270 K3529E probably damaging Het
Ecd T C 14: 20,320,791 N620S probably damaging Het
Fbn1 T A 2: 125,403,132 K278N possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fzd7 T G 1: 59,483,260 F101V probably damaging Het
Galnt13 G T 2: 54,516,479 probably benign Het
Gif G A 19: 11,750,285 A158T probably damaging Het
Gm32647 C T 7: 94,475,732 Het
Gm5624 A T 14: 44,559,876 D152E probably benign Het
Heatr6 T A 11: 83,772,503 V664E possibly damaging Het
Hpgd A G 8: 56,294,952 D36G probably damaging Het
Ifnlr1 A G 4: 135,703,797 T199A possibly damaging Het
Kalrn T G 16: 34,357,111 D228A probably damaging Het
Miox T C 15: 89,335,321 M47T probably damaging Het
Nampt A T 12: 32,830,302 I65F probably benign Het
Ncf1 T C 5: 134,226,633 K135E probably damaging Het
Nop53 G A 7: 15,938,389 Q452* probably null Het
Olfr1037 A G 2: 86,084,901 L292S probably damaging Het
Pik3cg A G 12: 32,204,359 V543A probably benign Het
Ralgds T C 2: 28,550,565 probably null Het
Rap1a A G 3: 105,750,282 V7A probably damaging Het
Rassf8 A G 6: 145,815,656 N236S probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sbno1 T C 5: 124,378,491 D1272G probably benign Het
Setx A G 2: 29,148,027 D1508G probably benign Het
Slc1a1 T A 19: 28,905,410 L358Q probably damaging Het
Slc7a12 C A 3: 14,499,126 L20I probably benign Het
Spats2l C T 1: 57,902,143 T187M probably damaging Het
Specc1l A G 10: 75,246,660 D647G probably benign Het
Steap4 G A 5: 7,978,562 R380Q probably damaging Het
Syne2 A G 12: 75,905,325 S456G probably benign Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tns2 T A 15: 102,107,030 D122E probably damaging Het
Tshr A G 12: 91,538,234 M649V probably benign Het
Ubr3 A G 2: 69,993,763 T1440A probably benign Het
Urb2 A G 8: 124,030,092 D846G probably benign Het
Vmn1r202 T C 13: 22,501,462 T262A possibly damaging Het
Vmn2r61 G T 7: 42,267,031 W356L probably damaging Het
Wdr11 T A 7: 129,618,703 M605K possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Rasal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Rasal1 APN 5 120664807 missense probably damaging 1.00
IGL01700:Rasal1 APN 5 120676817 missense probably benign 0.06
IGL01790:Rasal1 APN 5 120670318 missense possibly damaging 0.61
IGL01866:Rasal1 APN 5 120675423 missense probably damaging 1.00
IGL02143:Rasal1 APN 5 120652852 missense probably damaging 1.00
IGL02527:Rasal1 APN 5 120666404 missense probably damaging 0.98
IGL02565:Rasal1 APN 5 120676780 splice site probably benign
IGL02710:Rasal1 APN 5 120666431 missense possibly damaging 0.71
PIT4618001:Rasal1 UTSW 5 120670376 missense probably damaging 0.99
R0270:Rasal1 UTSW 5 120674729 missense probably damaging 0.97
R0281:Rasal1 UTSW 5 120674605 missense probably benign
R0673:Rasal1 UTSW 5 120670384 missense probably benign 0.26
R1227:Rasal1 UTSW 5 120670307 missense probably damaging 0.99
R1475:Rasal1 UTSW 5 120662982 missense possibly damaging 0.55
R1486:Rasal1 UTSW 5 120654852 missense probably damaging 1.00
R1557:Rasal1 UTSW 5 120676849 missense possibly damaging 0.87
R1651:Rasal1 UTSW 5 120652845 nonsense probably null
R1792:Rasal1 UTSW 5 120664756 missense probably benign 0.06
R2148:Rasal1 UTSW 5 120662031 missense probably damaging 0.97
R2964:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2966:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2983:Rasal1 UTSW 5 120654862 missense probably benign 0.45
R4090:Rasal1 UTSW 5 120675609 missense possibly damaging 0.95
R4205:Rasal1 UTSW 5 120659563 missense probably benign 0.21
R4643:Rasal1 UTSW 5 120678964 missense probably benign 0.05
R4979:Rasal1 UTSW 5 120678676 missense probably benign
R5171:Rasal1 UTSW 5 120663764 missense probably benign
R5187:Rasal1 UTSW 5 120675395 missense probably benign 0.13
R5877:Rasal1 UTSW 5 120679070 utr 3 prime probably benign
R5924:Rasal1 UTSW 5 120675517 missense probably damaging 1.00
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6159:Rasal1 UTSW 5 120659608 missense probably damaging 1.00
R6292:Rasal1 UTSW 5 120659620 missense probably damaging 0.97
R6548:Rasal1 UTSW 5 120674725 missense probably benign 0.00
R7042:Rasal1 UTSW 5 120663960 splice site probably null
R7194:Rasal1 UTSW 5 120675492 missense probably benign
R7356:Rasal1 UTSW 5 120654825 missense possibly damaging 0.65
R7406:Rasal1 UTSW 5 120662937 missense probably benign 0.11
R7662:Rasal1 UTSW 5 120662184 missense probably benign 0.36
X0057:Rasal1 UTSW 5 120664512 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACAACAGAGCTATCAGGAATTG -3'
(R):5'- TGTTGGAAACAGGACTTGCATG -3'

Sequencing Primer
(F):5'- CTATCAGGAATTGAATATGGGGCCTC -3'
(R):5'- CAACTTGGTATCAGCTAATAGGACC -3'
Posted On2017-10-10