Incidental Mutation 'R6171:Xylb'
ID490446
Institutional Source Beutler Lab
Gene Symbol Xylb
Ensembl Gene ENSMUSG00000035769
Gene Namexylulokinase homolog (H. influenzae)
Synonyms
MMRRC Submission 044314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6171 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119357381-119393797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119381591 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 380 (T380M)
Ref Sequence ENSEMBL: ENSMUSP00000047254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039610] [ENSMUST00000215822] [ENSMUST00000216838]
Predicted Effect probably damaging
Transcript: ENSMUST00000039610
AA Change: T380M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047254
Gene: ENSMUSG00000035769
AA Change: T380M

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
Pfam:FGGY_N 144 302 3.9e-15 PFAM
Pfam:FGGY_C 310 496 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213383
Predicted Effect probably benign
Transcript: ENSMUST00000215822
Predicted Effect probably benign
Transcript: ENSMUST00000216838
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares 22% sequence identity with Hemophilus influenzae xylulokinase, and even higher identity to other gene products in C.elegans (45%) and yeast (31-35%), which are thought to belong to a family of enzymes that include fucokinase, gluconokinase, glycerokinase and xylulokinase. These proteins play important roles in energy metabolism. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 A G 4: 126,317,317 V269A probably damaging Het
Atp11a T A 8: 12,832,663 V517D probably damaging Het
Atr C T 9: 95,881,271 Q1073* probably null Het
C87436 A C 6: 86,445,467 T8P probably benign Het
Clasrp T C 7: 19,584,822 probably benign Het
Creb3l1 G T 2: 91,991,269 Q254K probably damaging Het
Dapl1 C A 2: 59,496,602 T64K probably benign Het
Dnah2 A T 11: 69,423,042 L4168Q probably damaging Het
Dnttip2 T A 3: 122,278,862 I597N probably damaging Het
Dyrk1b A T 7: 28,186,550 probably null Het
Elk3 G T 10: 93,250,044 P132Q probably damaging Het
Galt C T 4: 41,757,541 P238S probably damaging Het
Gm10322 T C 10: 59,616,262 V67A possibly damaging Het
Ice1 T C 13: 70,606,731 Y412C probably benign Het
Kcna1 A T 6: 126,642,323 Y345N probably damaging Het
Kif1b T C 4: 149,258,048 Y419C probably damaging Het
Klf15 G T 6: 90,466,619 A59S possibly damaging Het
Mettl17 T A 14: 51,888,779 Y162N probably damaging Het
Myh10 G A 11: 68,791,890 R1050Q probably damaging Het
Nek4 T C 14: 30,970,347 V376A probably benign Het
Nemp1 T A 10: 127,689,450 probably null Het
Nlrp9a T C 7: 26,558,763 I602T possibly damaging Het
Nphp4 T C 4: 152,544,449 V764A probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr895 C T 9: 38,268,602 Q22* probably null Het
Osbp2 A T 11: 3,717,221 probably null Het
Pax2 A G 19: 44,790,740 Y185C probably damaging Het
Pdyn A T 2: 129,688,348 S134T possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ppp1r13l A G 7: 19,377,511 M754V probably benign Het
Prr23a3 T A 9: 98,865,678 N228K probably benign Het
Psmd12 T C 11: 107,491,907 F213L probably damaging Het
Qser1 A T 2: 104,789,283 S395T probably damaging Het
Rab7b A G 1: 131,698,634 probably null Het
Rev3l T A 10: 39,862,713 L2821* probably null Het
Rplp0 A G 5: 115,561,160 N127S probably benign Het
Serpina9 G T 12: 104,008,419 Y158* probably null Het
Sis G A 3: 72,961,027 T110M possibly damaging Het
Slc43a2 A G 11: 75,563,050 Y263C probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stard13 A T 5: 151,092,762 V88E probably damaging Het
Trim29 G A 9: 43,319,377 E286K probably damaging Het
Vmn2r24 T C 6: 123,787,246 S361P probably damaging Het
Wnk2 T C 13: 49,060,832 T18A probably damaging Het
Zbtb5 T C 4: 44,994,119 T422A probably benign Het
Zhx2 A G 15: 57,823,206 E657G probably damaging Het
Other mutations in Xylb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Xylb APN 9 119390483 nonsense probably null
R0330:Xylb UTSW 9 119381587 missense probably damaging 0.98
R0959:Xylb UTSW 9 119380025 missense possibly damaging 0.85
R1127:Xylb UTSW 9 119383377 missense probably damaging 0.99
R1401:Xylb UTSW 9 119368067 splice site probably benign
R1417:Xylb UTSW 9 119364540 missense probably benign 0.04
R2315:Xylb UTSW 9 119359269 missense probably benign 0.22
R2322:Xylb UTSW 9 119388747 missense possibly damaging 0.95
R3884:Xylb UTSW 9 119380687 missense probably damaging 1.00
R4367:Xylb UTSW 9 119388715 missense probably benign 0.10
R4463:Xylb UTSW 9 119386367 missense probably benign 0.00
R4750:Xylb UTSW 9 119359313 nonsense probably null
R5181:Xylb UTSW 9 119364501 missense probably damaging 1.00
R5568:Xylb UTSW 9 119361132 missense probably benign 0.43
R6104:Xylb UTSW 9 119364507 makesense probably null
R6642:Xylb UTSW 9 119367493 missense probably damaging 1.00
R6643:Xylb UTSW 9 119367493 missense probably damaging 1.00
R6836:Xylb UTSW 9 119391754 missense probably damaging 1.00
R7121:Xylb UTSW 9 119382292 missense probably benign 0.00
R7496:Xylb UTSW 9 119391816 makesense probably null
R7776:Xylb UTSW 9 119380700 critical splice donor site probably null
R7908:Xylb UTSW 9 119381545 missense probably benign 0.00
R7989:Xylb UTSW 9 119381545 missense probably benign 0.00
R8025:Xylb UTSW 9 119381503 missense probably damaging 0.99
Z1088:Xylb UTSW 9 119381614 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGAGAAAATCCTTGCCTAGCATG -3'
(R):5'- ACCTTTCACTGGAGGTTTAGGG -3'

Sequencing Primer
(F):5'- CTTTAAAAACGGCTCCCTC -3'
(R):5'- GTTTAGGGAGCAGCAGCC -3'
Posted On2017-10-10