Incidental Mutation 'R6171:Psmd12'
ID490453
Institutional Source Beutler Lab
Gene Symbol Psmd12
Ensembl Gene ENSMUSG00000020720
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms1500002F15Rik, P55
MMRRC Submission 044314-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6171 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location107479484-107504362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107491907 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 213 (F213L)
Ref Sequence ENSEMBL: ENSMUSP00000102363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021063] [ENSMUST00000106750] [ENSMUST00000106752]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021063
AA Change: F213L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021063
Gene: ENSMUSG00000020720
AA Change: F213L

DomainStartEndE-ValueType
PINT 349 435 3.24e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106750
AA Change: F193L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102361
Gene: ENSMUSG00000020720
AA Change: F193L

DomainStartEndE-ValueType
PINT 329 415 3.24e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106752
AA Change: F213L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102363
Gene: ENSMUSG00000020720
AA Change: F213L

DomainStartEndE-ValueType
Pfam:PCI 300 398 1.3e-15 PFAM
Meta Mutation Damage Score 0.2058 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 A G 4: 126,317,317 V269A probably damaging Het
Atp11a T A 8: 12,832,663 V517D probably damaging Het
Atr C T 9: 95,881,271 Q1073* probably null Het
C87436 A C 6: 86,445,467 T8P probably benign Het
Clasrp T C 7: 19,584,822 probably benign Het
Creb3l1 G T 2: 91,991,269 Q254K probably damaging Het
Dapl1 C A 2: 59,496,602 T64K probably benign Het
Dnah2 A T 11: 69,423,042 L4168Q probably damaging Het
Dnttip2 T A 3: 122,278,862 I597N probably damaging Het
Dyrk1b A T 7: 28,186,550 probably null Het
Elk3 G T 10: 93,250,044 P132Q probably damaging Het
Galt C T 4: 41,757,541 P238S probably damaging Het
Gm10322 T C 10: 59,616,262 V67A possibly damaging Het
Ice1 T C 13: 70,606,731 Y412C probably benign Het
Kcna1 A T 6: 126,642,323 Y345N probably damaging Het
Kif1b T C 4: 149,258,048 Y419C probably damaging Het
Klf15 G T 6: 90,466,619 A59S possibly damaging Het
Mettl17 T A 14: 51,888,779 Y162N probably damaging Het
Myh10 G A 11: 68,791,890 R1050Q probably damaging Het
Nek4 T C 14: 30,970,347 V376A probably benign Het
Nemp1 T A 10: 127,689,450 probably null Het
Nlrp9a T C 7: 26,558,763 I602T possibly damaging Het
Nphp4 T C 4: 152,544,449 V764A probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr895 C T 9: 38,268,602 Q22* probably null Het
Osbp2 A T 11: 3,717,221 probably null Het
Pax2 A G 19: 44,790,740 Y185C probably damaging Het
Pdyn A T 2: 129,688,348 S134T possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ppp1r13l A G 7: 19,377,511 M754V probably benign Het
Prr23a3 T A 9: 98,865,678 N228K probably benign Het
Qser1 A T 2: 104,789,283 S395T probably damaging Het
Rab7b A G 1: 131,698,634 probably null Het
Rev3l T A 10: 39,862,713 L2821* probably null Het
Rplp0 A G 5: 115,561,160 N127S probably benign Het
Serpina9 G T 12: 104,008,419 Y158* probably null Het
Sis G A 3: 72,961,027 T110M possibly damaging Het
Slc43a2 A G 11: 75,563,050 Y263C probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stard13 A T 5: 151,092,762 V88E probably damaging Het
Trim29 G A 9: 43,319,377 E286K probably damaging Het
Vmn2r24 T C 6: 123,787,246 S361P probably damaging Het
Wnk2 T C 13: 49,060,832 T18A probably damaging Het
Xylb C T 9: 119,381,591 T380M probably damaging Het
Zbtb5 T C 4: 44,994,119 T422A probably benign Het
Zhx2 A G 15: 57,823,206 E657G probably damaging Het
Other mutations in Psmd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03002:Psmd12 APN 11 107485781 missense probably benign 0.00
R0384:Psmd12 UTSW 11 107485721 missense probably benign 0.00
R1457:Psmd12 UTSW 11 107479646 missense probably damaging 1.00
R1661:Psmd12 UTSW 11 107491906 missense probably damaging 1.00
R2443:Psmd12 UTSW 11 107495737 missense probably damaging 1.00
R3806:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3807:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3840:Psmd12 UTSW 11 107485572 missense probably benign 0.02
R4212:Psmd12 UTSW 11 107485759 missense probably damaging 1.00
R4718:Psmd12 UTSW 11 107486433 missense probably benign 0.15
R5182:Psmd12 UTSW 11 107479659 missense probably damaging 1.00
R5586:Psmd12 UTSW 11 107486475 missense probably benign 0.35
R6444:Psmd12 UTSW 11 107486454 missense possibly damaging 0.55
R6527:Psmd12 UTSW 11 107488968 missense probably damaging 0.96
R7276:Psmd12 UTSW 11 107503645 nonsense probably null
R7466:Psmd12 UTSW 11 107492057 missense probably benign 0.03
R7751:Psmd12 UTSW 11 107479613 missense possibly damaging 0.68
R7779:Psmd12 UTSW 11 107497579 missense probably benign 0.01
Z1177:Psmd12 UTSW 11 107485557 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ACGTGATCTGACTGACTGTTTC -3'
(R):5'- GGGAGTGTCATAGATGGCTC -3'

Sequencing Primer
(F):5'- CTGACTGTTTCAGTATCCATTGAG -3'
(R):5'- TTTGCAGATGGACAGATAGGACCC -3'
Posted On2017-10-10