Incidental Mutation 'R4604:Arl6ip1'
ID500693
Institutional Source Beutler Lab
Gene Symbol Arl6ip1
Ensembl Gene ENSMUSG00000030654
Gene NameADP-ribosylation factor-like 6 interacting protein 1
SynonymsAIP-6, ARMER
MMRRC Submission 041816-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4604 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location118118891-118129662 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) AAAATAAATAAATAAATAAATAAATA to AAAATAAATAAATAAATAAATAAATAAATA at 118121899 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032888] [ENSMUST00000203154] [ENSMUST00000204005] [ENSMUST00000206491]
Predicted Effect probably benign
Transcript: ENSMUST00000032888
SMART Domains Protein: ENSMUSP00000032888
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 136 153 N/A INTRINSIC
transmembrane domain 158 180 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203154
Predicted Effect probably benign
Transcript: ENSMUST00000204005
SMART Domains Protein: ENSMUSP00000145418
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205182
Predicted Effect probably benign
Transcript: ENSMUST00000206491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206536
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ARL6ip family and encodes a transmembrane protein that is predominantly localized to intracytoplasmic membranes. It is highly expressed in early myeloid progenitor cells and thought to be involved in protein transport, membrane trafficking, or cell signaling during hematopoietic maturation. Mutations in this gene are associated with spastic paraplegia 61 (SPG61). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik C T 2: 156,857,154 probably benign Het
Abcb6 G A 1: 75,179,877 T81I probably benign Het
Acp6 A G 3: 97,175,759 K362R probably benign Het
Adam26a A G 8: 43,570,051 M134T probably benign Het
Ankrd27 C T 7: 35,628,490 P812S probably damaging Het
Atp2a1 G A 7: 126,448,623 R672C probably damaging Het
Atxn2 G T 5: 121,781,343 W371C probably damaging Het
B3gnt2 T TTCACAAA 11: 22,836,426 probably null Het
Btnl6 T A 17: 34,508,461 D365V possibly damaging Het
Ccdc80 T A 16: 45,095,565 L228Q probably damaging Het
Cdc42bpa A G 1: 180,109,194 H718R probably benign Het
Cdh18 A G 15: 23,474,368 K775E probably benign Het
Cdh23 T G 10: 60,337,666 N1679T possibly damaging Het
Cep192 T A 18: 67,815,922 D271E possibly damaging Het
Cfap70 G T 14: 20,443,661 T124K probably benign Het
Ckap5 A T 2: 91,578,131 E890D probably benign Het
Col22a1 G T 15: 71,952,339 P569T probably benign Het
Colq A T 14: 31,545,103 L150Q possibly damaging Het
Csf1 T C 3: 107,756,962 probably null Het
Csmd3 A T 15: 48,004,815 S770T possibly damaging Het
Cul9 C A 17: 46,530,146 V733L probably damaging Het
Cyp2c55 A G 19: 39,031,386 D256G possibly damaging Het
D17Wsu92e T C 17: 27,820,315 D7G probably damaging Het
Dclk3 A T 9: 111,469,185 D599V probably damaging Het
Defb26 T A 2: 152,508,184 I59F possibly damaging Het
Dnah6 A G 6: 73,129,660 V1646A possibly damaging Het
Dnm2 T C 9: 21,504,664 probably null Het
Dock6 A G 9: 21,802,540 L1867P probably damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Dync2h1 T C 9: 7,140,995 H1344R probably benign Het
Enam A C 5: 88,504,283 Q1217P possibly damaging Het
Fbf1 A T 11: 116,158,922 D91E possibly damaging Het
Fbxo7 T G 10: 86,046,802 W393G probably damaging Het
Gab2 A G 7: 97,304,213 T599A probably damaging Het
Gfy T A 7: 45,177,188 I409F possibly damaging Het
Gm19345 T A 7: 19,857,508 probably null Het
Gm4787 A G 12: 81,379,213 M57T probably benign Het
Gper1 A G 5: 139,426,725 E275G probably damaging Het
Grik4 T C 9: 42,524,586 E803G probably damaging Het
Gstm3 G A 3: 107,968,197 P39L possibly damaging Het
Hax1 A T 3: 89,997,460 V142D probably damaging Het
Hcn3 A T 3: 89,150,440 I383N probably damaging Het
Hdac10 C A 15: 89,125,397 probably null Het
Hipk3 A C 2: 104,439,329 M505R probably damaging Het
Hivep1 C T 13: 42,159,749 P1822S probably benign Het
Hsd17b13 G T 5: 103,956,258 H281N unknown Het
Irak2 T A 6: 113,672,887 I222N probably damaging Het
Kalrn G A 16: 34,513,926 L7F possibly damaging Het
Kcnma1 A G 14: 23,309,038 probably null Het
Kcnn3 G T 3: 89,520,420 probably benign Het
Lamb1 A C 12: 31,278,776 D218A probably damaging Het
Lrrtm1 A T 6: 77,244,144 N195Y probably damaging Het
Ltf A T 9: 111,022,341 N72I probably damaging Het
Mcm4 A G 16: 15,629,663 I479T probably damaging Het
Mfhas1 T C 8: 35,588,610 S80P probably benign Het
Mknk1 A G 4: 115,878,027 E364G probably damaging Het
Msh4 C T 3: 153,872,283 C458Y probably damaging Het
Mtrr A T 13: 68,564,512 probably null Het
Myo1a T C 10: 127,711,138 W356R probably damaging Het
Nbea A G 3: 55,723,648 V2186A probably benign Het
Nfe2l3 T C 6: 51,451,012 S185P probably damaging Het
Nhsl1 A C 10: 18,531,410 K1397Q probably damaging Het
Nmbr C T 10: 14,770,164 R261W probably damaging Het
Npy2r A G 3: 82,541,058 S137P probably damaging Het
Obscn C T 11: 59,080,205 G2494D probably damaging Het
Obscn T C 11: 59,122,746 K1092E probably damaging Het
Olfr1019 C T 2: 85,841,182 C203Y probably damaging Het
Oosp2 A C 19: 11,649,683 I92S probably benign Het
Pcdh9 T C 14: 93,887,180 D518G probably damaging Het
Pde11a G T 2: 76,337,793 T272K possibly damaging Het
Plekha2 T A 8: 25,059,835 Q162L probably null Het
Prkag2 T A 5: 24,878,734 I84F probably damaging Het
Prm2 G T 16: 10,791,749 probably benign Het
Prpf40a A T 2: 53,142,023 C800S probably damaging Het
Prr5l A T 2: 101,729,448 C158S probably benign Het
Prrt3 C A 6: 113,498,237 C8F possibly damaging Het
Psg25 T C 7: 18,529,803 T32A probably benign Het
Ruvbl1 T C 6: 88,485,905 V337A probably benign Het
Sall1 T A 8: 89,030,341 Q1045L probably damaging Het
Sec22c T C 9: 121,695,642 Y25C probably damaging Het
Serpina3i A T 12: 104,267,777 T335S possibly damaging Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc12a8 T A 16: 33,608,159 I279N probably damaging Het
Slc15a1 G A 14: 121,489,907 T83I probably damaging Het
Slc22a3 A G 17: 12,459,771 F222S probably benign Het
Sorcs3 A T 19: 48,693,914 T463S probably benign Het
Spsb4 C A 9: 96,995,878 A131S probably benign Het
Syne2 A G 12: 75,967,710 E3225G probably damaging Het
Tchp G A 5: 114,719,573 probably null Het
Tekt4 T A 17: 25,471,775 D18E probably benign Het
Timm50 A G 7: 28,311,018 V37A probably benign Het
Tlx2 A C 6: 83,068,760 *285G probably null Het
Tmem173 T A 18: 35,738,690 I170F probably damaging Het
Tshz1 C A 18: 84,013,374 D970Y probably damaging Het
Ttn A T 2: 76,870,461 V50E probably damaging Het
Txndc17 T A 11: 72,209,448 S113T probably benign Het
Tyk2 T C 9: 21,108,009 Y1039C probably damaging Het
Ubqln3 A G 7: 104,142,491 S131P probably benign Het
Uncx A T 5: 139,544,082 H30L possibly damaging Het
Usp25 T A 16: 77,115,415 D1007E probably damaging Het
Usp47 T C 7: 112,101,831 V1083A probably damaging Het
Wdr24 T A 17: 25,828,505 H765Q probably damaging Het
Wrnip1 A G 13: 32,802,347 D37G probably damaging Het
Xpo6 T C 7: 126,113,752 T686A possibly damaging Het
Zfp941 G A 7: 140,812,211 R412C probably damaging Het
Znrf2 T A 6: 54,878,440 C71* probably null Het
Other mutations in Arl6ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1412:Arl6ip1 UTSW 7 118120368 missense possibly damaging 0.96
R4155:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4156:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4157:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4201:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4206:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4271:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4276:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4277:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4278:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4280:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4281:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4283:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4330:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4502:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4503:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4547:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4548:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4580:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4774:Arl6ip1 UTSW 7 118121985 missense probably damaging 1.00
R4804:Arl6ip1 UTSW 7 118129552 splice site probably null
R4805:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4807:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R6211:Arl6ip1 UTSW 7 118127250 missense probably benign 0.44
R6651:Arl6ip1 UTSW 7 118129485 missense probably benign 0.00
R7548:Arl6ip1 UTSW 7 118126510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACCTTCCCAGTTAGCAC -3'
(R):5'- GGAGGTCAAGAGTCTTAGCTG -3'

Sequencing Primer
(F):5'- CCAGTTAGCACTTCCCACC -3'
(R):5'- GTGGAAACGCCTCTTTTC -3'
Posted On2017-12-01