Incidental Mutation 'R6187:Ciz1'
ID502212
Institutional Source Beutler Lab
Gene Symbol Ciz1
Ensembl Gene ENSMUSG00000039205
Gene NameCDKN1A interacting zinc finger protein 1
Synonyms0610038H21Rik, 2900056O04Rik
MMRRC Submission 044327-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R6187 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32352327-32380970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32370051 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 203 (V203E)
Ref Sequence ENSEMBL: ENSMUSP00000116812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048964] [ENSMUST00000113331] [ENSMUST00000113332] [ENSMUST00000113334] [ENSMUST00000113338] [ENSMUST00000131152] [ENSMUST00000132028] [ENSMUST00000136079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048964
AA Change: V203E

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048428
Gene: ENSMUSG00000039205
AA Change: V203E

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113331
AA Change: V179E

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108957
Gene: ENSMUSG00000039205
AA Change: V179E

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
low complexity region 221 232 N/A INTRINSIC
internal_repeat_2 252 284 9.48e-5 PROSPERO
internal_repeat_2 301 333 9.48e-5 PROSPERO
low complexity region 337 366 N/A INTRINSIC
ZnF_U1 510 544 1.23e-1 SMART
ZnF_C2H2 513 537 1.99e0 SMART
ZnF_U1 602 636 2.08e-1 SMART
ZnF_C2H2 605 629 3.02e0 SMART
low complexity region 665 685 N/A INTRINSIC
ZnF_U1 720 755 1.43e-4 SMART
ZnF_C2H2 723 748 9.56e1 SMART
low complexity region 799 821 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113332
AA Change: V198E

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108958
Gene: ENSMUSG00000039205
AA Change: V198E

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
ZnF_U1 480 514 1.23e-1 SMART
ZnF_C2H2 483 507 1.99e0 SMART
Blast:ZnF_U1 543 570 2e-6 BLAST
ZnF_U1 572 606 2.08e-1 SMART
ZnF_C2H2 575 599 3.02e0 SMART
low complexity region 635 655 N/A INTRINSIC
ZnF_U1 690 725 1.43e-4 SMART
ZnF_C2H2 693 718 9.56e1 SMART
low complexity region 769 791 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113334
AA Change: V203E

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108960
Gene: ENSMUSG00000039205
AA Change: V203E

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113338
AA Change: V203E

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108964
Gene: ENSMUSG00000039205
AA Change: V203E

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125482
SMART Domains Protein: ENSMUSP00000120019
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
ZnF_C2H2 216 240 1.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125769
Predicted Effect probably benign
Transcript: ENSMUST00000131152
SMART Domains Protein: ENSMUSP00000141211
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132028
SMART Domains Protein: ENSMUSP00000120295
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134141
Predicted Effect possibly damaging
Transcript: ENSMUST00000136079
AA Change: V203E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116812
Gene: ENSMUSG00000039205
AA Change: V203E

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137220
Predicted Effect unknown
Transcript: ENSMUST00000139637
AA Change: V42E
SMART Domains Protein: ENSMUSP00000122469
Gene: ENSMUSG00000039205
AA Change: V42E

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
low complexity region 201 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145957
Predicted Effect unknown
Transcript: ENSMUST00000151806
AA Change: V27E
SMART Domains Protein: ENSMUSP00000119429
Gene: ENSMUSG00000039205
AA Change: V27E

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice hoomozygous for a knock-out allele exhibit decreased body size and gender specific effects on motor phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,270,599 probably benign Het
Abca13 T A 11: 9,309,085 L2937H probably damaging Het
Abca3 A G 17: 24,408,167 I1281V possibly damaging Het
Adam2 A T 14: 66,068,619 S138T possibly damaging Het
Adamts4 C T 1: 171,250,993 P61S probably damaging Het
Adamts6 C T 13: 104,297,425 P121S probably damaging Het
AF529169 A G 9: 89,591,167 I897T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ak1 G A 2: 32,633,477 V186M probably damaging Het
Alpk1 T C 3: 127,673,342 Y1096C probably damaging Het
Ankrd29 A C 18: 12,279,690 Y73* probably null Het
Asah2 A T 19: 32,024,867 S292R probably damaging Het
Atp6v1b1 A T 6: 83,752,395 T105S probably damaging Het
Axdnd1 T A 1: 156,365,612 probably null Het
Bub1b T G 2: 118,631,000 S678A probably damaging Het
Cenpq T A 17: 40,927,198 M142L probably benign Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Cyp2c68 A T 19: 39,741,008 S12T probably benign Het
Cyp4f18 C A 8: 71,993,186 A322S probably damaging Het
Disp2 A G 2: 118,792,143 S1119G probably damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Faxc A G 4: 21,958,445 T201A possibly damaging Het
Fbxw14 A G 9: 109,276,264 S278P probably damaging Het
Fpr1 G T 17: 17,876,928 C266* probably null Het
Fsip2 T C 2: 82,982,454 I3039T probably benign Het
Gas1 G T 13: 60,176,372 S190R possibly damaging Het
Gemin2 A G 12: 59,013,585 T37A probably damaging Het
Gm21370 T C 13: 120,026,867 I49V probably benign Het
Gm8444 T C 15: 81,843,606 probably benign Het
Gpr1 T C 1: 63,183,275 E267G probably damaging Het
Gria1 A G 11: 57,238,110 D401G possibly damaging Het
Gstk1 G A 6: 42,249,860 V187I possibly damaging Het
Hmcn1 T C 1: 150,630,728 D3776G probably damaging Het
Itfg1 A C 8: 85,836,465 V102G probably damaging Het
Kidins220 A G 12: 25,051,308 probably null Het
Kif13b A C 14: 64,736,215 D338A probably damaging Het
Mab21l2 T C 3: 86,547,258 Y145C probably damaging Het
Magel2 A G 7: 62,377,641 M98V unknown Het
Mdfic T C 6: 15,721,197 probably benign Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mycbp2 A G 14: 103,147,017 L3475P probably damaging Het
Myh14 G A 7: 44,627,033 T1216I probably damaging Het
Nfatc2 T A 2: 168,480,238 I914F probably benign Het
Nupl1 T C 14: 60,240,807 probably null Het
Olfr1115 T A 2: 87,252,698 S254T probably damaging Het
Olfr120 T C 17: 37,726,141 L48P probably damaging Het
Olfr1383 G T 11: 49,523,511 probably benign Het
Olfr469 A T 7: 107,822,574 N298K probably benign Het
Olfr535 A G 7: 140,492,616 probably benign Het
Olfr724 A G 14: 49,961,069 M1T probably null Het
Olfr835 A C 9: 19,035,393 Q90P probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Oxr1 A G 15: 41,825,919 Q513R probably damaging Het
Padi1 C T 4: 140,826,965 V310M probably damaging Het
Pard3 T C 8: 127,073,273 L11S probably benign Het
Pcdhb14 A T 18: 37,448,444 D201V probably damaging Het
Pcdhb7 A G 18: 37,342,569 R253G probably benign Het
Plxnb2 C T 15: 89,167,258 D253N probably damaging Het
Ppp2cb T C 8: 33,615,474 S171P probably damaging Het
Prr5 C T 15: 84,693,772 T94M probably damaging Het
Rp1 A G 1: 4,349,869 F340S probably damaging Het
Rpa1 C G 11: 75,310,236 G433A probably benign Het
Smg1 A T 7: 118,189,163 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Homo
Svep1 C T 4: 58,072,872 G2146R probably damaging Het
Tas2r106 A G 6: 131,678,210 M226T probably damaging Het
Tbk1 T C 10: 121,584,243 I14V probably benign Het
Tekt4 G C 17: 25,472,223 V168L probably damaging Het
Tnfaip1 T A 11: 78,527,546 T232S probably damaging Het
Trio C T 15: 27,743,952 probably null Het
Ttn T A 2: 76,944,437 Y2133F unknown Het
Uap1l1 C T 2: 25,362,729 R433H probably damaging Het
Ugt2b35 T C 5: 87,007,322 F339L probably damaging Het
Unc5b T C 10: 60,772,224 Y699C probably damaging Het
Vcpip1 T C 1: 9,724,780 H1122R probably damaging Het
Vmn2r91 T C 17: 18,106,626 V391A probably benign Het
Vps13c C T 9: 67,915,657 R1327W probably damaging Het
Yes1 A G 5: 32,645,041 Y100C probably damaging Het
Zfp407 A T 18: 84,559,009 N1326K possibly damaging Het
Zfp518a G A 19: 40,915,446 C1273Y probably benign Het
Zfr AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA AGCAGCAGCA 15: 12,146,231 probably benign Het
Other mutations in Ciz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Ciz1 APN 2 32372388 missense probably damaging 1.00
IGL01872:Ciz1 APN 2 32378109 utr 3 prime probably benign
R0029:Ciz1 UTSW 2 32371419 splice site probably benign
R0122:Ciz1 UTSW 2 32371419 splice site probably benign
R0363:Ciz1 UTSW 2 32377363 critical splice donor site probably null
R0373:Ciz1 UTSW 2 32367467 missense probably damaging 1.00
R0653:Ciz1 UTSW 2 32372406 missense probably damaging 1.00
R0816:Ciz1 UTSW 2 32376376 unclassified probably benign
R1255:Ciz1 UTSW 2 32365876 critical splice donor site probably null
R2116:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R3161:Ciz1 UTSW 2 32370063 missense probably benign 0.11
R3732:Ciz1 UTSW 2 32367483 missense possibly damaging 0.68
R4014:Ciz1 UTSW 2 32374344 missense probably damaging 0.96
R4386:Ciz1 UTSW 2 32370099 missense possibly damaging 0.92
R4687:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R4786:Ciz1 UTSW 2 32377527 missense probably damaging 1.00
R4825:Ciz1 UTSW 2 32371741 missense probably damaging 0.99
R4869:Ciz1 UTSW 2 32364235 missense probably damaging 0.99
R4871:Ciz1 UTSW 2 32372288 splice site probably benign
R5270:Ciz1 UTSW 2 32374499 unclassified probably null
R5429:Ciz1 UTSW 2 32376043 missense possibly damaging 0.93
R5621:Ciz1 UTSW 2 32371741 missense probably damaging 0.96
R5721:Ciz1 UTSW 2 32376040 missense probably damaging 1.00
R5805:Ciz1 UTSW 2 32367396 missense probably damaging 1.00
R5960:Ciz1 UTSW 2 32371216 missense possibly damaging 0.85
R6612:Ciz1 UTSW 2 32377311 missense possibly damaging 0.93
R7006:Ciz1 UTSW 2 32371115 critical splice donor site probably null
R7200:Ciz1 UTSW 2 32364287 missense probably damaging 1.00
R7498:Ciz1 UTSW 2 32371749 missense probably benign
X0018:Ciz1 UTSW 2 32371252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAGAGGGTTACAGCATTAC -3'
(R):5'- AGCATGCTATCTGGACCGAC -3'

Sequencing Primer
(F):5'- GCTGTGTCTAAAAAGCCCAG -3'
(R):5'- GCTATCTGGACCGACTAGTGAATC -3'
Posted On2018-02-27