Incidental Mutation 'R4687:Ciz1'
ID 353720
Institutional Source Beutler Lab
Gene Symbol Ciz1
Ensembl Gene ENSMUSG00000039205
Gene Name CDKN1A interacting zinc finger protein 1
Synonyms 0610038H21Rik, 2900056O04Rik
MMRRC Submission 041938-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R4687 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 32252724-32268311 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32257477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 174 (L174P)
Ref Sequence ENSEMBL: ENSMUSP00000116812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048964] [ENSMUST00000113331] [ENSMUST00000113332] [ENSMUST00000113334] [ENSMUST00000113338] [ENSMUST00000131152] [ENSMUST00000132028] [ENSMUST00000136079]
AlphaFold Q8VEH2
Predicted Effect probably damaging
Transcript: ENSMUST00000048964
AA Change: L174P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048428
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113331
AA Change: L150P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108957
Gene: ENSMUSG00000039205
AA Change: L150P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
low complexity region 221 232 N/A INTRINSIC
internal_repeat_2 252 284 9.48e-5 PROSPERO
internal_repeat_2 301 333 9.48e-5 PROSPERO
low complexity region 337 366 N/A INTRINSIC
ZnF_U1 510 544 1.23e-1 SMART
ZnF_C2H2 513 537 1.99e0 SMART
ZnF_U1 602 636 2.08e-1 SMART
ZnF_C2H2 605 629 3.02e0 SMART
low complexity region 665 685 N/A INTRINSIC
ZnF_U1 720 755 1.43e-4 SMART
ZnF_C2H2 723 748 9.56e1 SMART
low complexity region 799 821 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113332
AA Change: L174P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108958
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
ZnF_U1 480 514 1.23e-1 SMART
ZnF_C2H2 483 507 1.99e0 SMART
Blast:ZnF_U1 543 570 2e-6 BLAST
ZnF_U1 572 606 2.08e-1 SMART
ZnF_C2H2 575 599 3.02e0 SMART
low complexity region 635 655 N/A INTRINSIC
ZnF_U1 690 725 1.43e-4 SMART
ZnF_C2H2 693 718 9.56e1 SMART
low complexity region 769 791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113334
AA Change: L174P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108960
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113338
AA Change: L174P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108964
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125482
SMART Domains Protein: ENSMUSP00000120019
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
ZnF_C2H2 216 240 1.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125769
Predicted Effect probably benign
Transcript: ENSMUST00000131152
SMART Domains Protein: ENSMUSP00000141211
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132028
AA Change: L174P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120295
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139637
AA Change: L18P
SMART Domains Protein: ENSMUSP00000122469
Gene: ENSMUSG00000039205
AA Change: L18P

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
low complexity region 201 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Predicted Effect probably damaging
Transcript: ENSMUST00000136079
AA Change: L174P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116812
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192055
Predicted Effect probably benign
Transcript: ENSMUST00000151806
SMART Domains Protein: ENSMUSP00000119429
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice hoomozygous for a knock-out allele exhibit decreased body size and gender specific effects on motor phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,210,985 (GRCm39) Y45N probably damaging Het
Agbl3 T C 6: 34,775,261 (GRCm39) V189A probably damaging Het
Akip1 C A 7: 109,304,193 (GRCm39) S90* probably null Het
Amn A T 12: 111,242,502 (GRCm39) D439V probably benign Het
Arhgap17 T A 7: 122,920,826 (GRCm39) D149V probably damaging Het
Atp6v0a4 A T 6: 38,069,400 (GRCm39) I76N possibly damaging Het
Atp6v1h A T 1: 5,203,308 (GRCm39) N291I probably damaging Het
Baiap2l2 G T 15: 79,143,453 (GRCm39) P462T probably damaging Het
Bves C T 10: 45,230,936 (GRCm39) probably null Het
Cabp7 T A 11: 4,689,265 (GRCm39) K127* probably null Het
Cacna1h A G 17: 25,612,884 (GRCm39) V313A possibly damaging Het
Camkk2 T C 5: 122,891,787 (GRCm39) H245R probably damaging Het
Celsr1 T A 15: 85,816,661 (GRCm39) S1761C possibly damaging Het
Cfap46 T C 7: 139,207,372 (GRCm39) E1849G possibly damaging Het
Crim1 G T 17: 78,610,454 (GRCm39) C303F probably damaging Het
Cyp26c1 A G 19: 37,681,385 (GRCm39) Q396R probably damaging Het
Dnajc7 G A 11: 100,490,126 (GRCm39) P43L probably damaging Het
Dpf2 T C 19: 5,957,040 (GRCm39) H16R probably damaging Het
Dsp A G 13: 38,375,595 (GRCm39) T1127A probably damaging Het
Dst T C 1: 34,240,204 (GRCm39) L1525P probably damaging Het
Ehf T A 2: 103,097,471 (GRCm39) D192V probably damaging Het
Frem1 G T 4: 82,938,868 (GRCm39) N71K probably damaging Het
Furin T A 7: 80,043,195 (GRCm39) T339S probably benign Het
Gad1 T A 2: 70,431,064 (GRCm39) I569N possibly damaging Het
Gfi1 T C 5: 107,871,676 (GRCm39) K10R probably damaging Het
Gm20775 T A Y: 10,641,258 (GRCm39) noncoding transcript Homo
Gpn3 A C 5: 122,516,638 (GRCm39) D89A possibly damaging Het
Gpr18 T A 14: 122,149,090 (GRCm39) R312* probably null Het
Gsap T C 5: 21,451,969 (GRCm39) probably benign Het
H2-Ab1 C A 17: 34,483,783 (GRCm39) T48K probably damaging Het
Hmcn2 A T 2: 31,328,297 (GRCm39) N4326I probably benign Het
Igkv4-51 A C 6: 69,658,714 (GRCm39) probably benign Het
Insr T C 8: 3,211,709 (GRCm39) H1104R probably benign Het
Ipo13 A T 4: 117,758,773 (GRCm39) N697K probably benign Het
Iqcm T G 8: 76,489,617 (GRCm39) F362V probably damaging Het
Irak4 T C 15: 94,464,704 (GRCm39) S425P probably damaging Het
Jakmip2 T C 18: 43,710,477 (GRCm39) E242G possibly damaging Het
Kdm4a T C 4: 118,001,280 (GRCm39) K829R probably damaging Het
Kdr T C 5: 76,129,452 (GRCm39) N145S possibly damaging Het
Klra9 A T 6: 130,162,480 (GRCm39) D185E probably benign Het
Lcn12 T C 2: 25,383,333 (GRCm39) N15S probably benign Het
Mei4 T A 9: 81,809,370 (GRCm39) M151K probably damaging Het
Mmp3 T A 9: 7,451,223 (GRCm39) S320T probably benign Het
Mrps5 C G 2: 127,432,690 (GRCm39) A37G probably benign Het
Mttp A G 3: 137,798,496 (GRCm39) I800T possibly damaging Het
Nags A T 11: 102,039,022 (GRCm39) Q451L probably damaging Het
Nbea T C 3: 55,965,486 (GRCm39) T476A probably damaging Het
Ndufb10 T C 17: 24,941,393 (GRCm39) E145G possibly damaging Het
Neb T G 2: 52,194,047 (GRCm39) S660R possibly damaging Het
Nppb A G 4: 148,070,753 (GRCm39) K43E probably benign Het
Nup188 A T 2: 30,220,645 (GRCm39) Q906L probably benign Het
Or10k2 T A 8: 84,268,489 (GRCm39) S239T probably damaging Het
Or4c12 T C 2: 89,774,213 (GRCm39) D82G probably damaging Het
Or8c17 C A 9: 38,180,710 (GRCm39) N292K probably damaging Het
Or9s23 T C 1: 92,501,052 (GRCm39) I53T possibly damaging Het
Ovch2 T A 7: 107,395,755 (GRCm39) I88F possibly damaging Het
Palm3 A G 8: 84,756,564 (GRCm39) E692G probably benign Het
Pcsk6 T C 7: 65,633,501 (GRCm39) F578L probably damaging Het
Piezo2 A C 18: 63,203,034 (GRCm39) D1535E probably damaging Het
Ppp1r15b T C 1: 133,059,873 (GRCm39) V130A probably benign Het
Proca1 T C 11: 78,095,724 (GRCm39) Y32H probably damaging Het
Prtg T A 9: 72,798,080 (GRCm39) V682E probably damaging Het
Pyroxd1 A T 6: 142,307,594 (GRCm39) M455L probably benign Het
Rasa1 T C 13: 85,374,754 (GRCm39) D739G possibly damaging Het
Scn3a T C 2: 65,295,074 (GRCm39) I1550V possibly damaging Het
Sepsecs T C 5: 52,801,213 (GRCm39) D483G probably benign Het
Setd7 T C 3: 51,457,776 (GRCm39) D17G probably damaging Het
Sipa1l2 C T 8: 126,217,984 (GRCm39) C451Y probably damaging Het
Slc31a1 A G 4: 62,306,939 (GRCm39) Y165C probably damaging Het
Smg5 T C 3: 88,249,776 (GRCm39) F68L possibly damaging Het
Sptbn5 A G 2: 119,907,689 (GRCm39) probably benign Het
Stk3 A G 15: 35,114,711 (GRCm39) I65T probably damaging Het
Tas2r115 C T 6: 132,714,247 (GRCm39) A235T possibly damaging Het
Tenm2 C T 11: 35,939,924 (GRCm39) A1400T probably benign Het
Tet1 T A 10: 62,674,570 (GRCm39) N1169Y probably benign Het
Treml2 T A 17: 48,616,425 (GRCm39) probably null Het
Tspan11 A G 6: 127,915,198 (GRCm39) E104G probably damaging Het
Wdtc1 G A 4: 133,023,742 (GRCm39) A543V probably damaging Het
Zfp148 T A 16: 33,317,189 (GRCm39) D578E probably damaging Het
Zfp735 A T 11: 73,602,682 (GRCm39) N542I probably damaging Het
Zfp735 A T 11: 73,602,681 (GRCm39) N542Y probably damaging Het
Zfp869 T A 8: 70,160,793 (GRCm39) E65D probably benign Het
Other mutations in Ciz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Ciz1 APN 2 32,262,400 (GRCm39) missense probably damaging 1.00
IGL01872:Ciz1 APN 2 32,268,121 (GRCm39) utr 3 prime probably benign
R0029:Ciz1 UTSW 2 32,261,431 (GRCm39) splice site probably benign
R0122:Ciz1 UTSW 2 32,261,431 (GRCm39) splice site probably benign
R0363:Ciz1 UTSW 2 32,267,375 (GRCm39) critical splice donor site probably null
R0373:Ciz1 UTSW 2 32,257,479 (GRCm39) missense probably damaging 1.00
R0653:Ciz1 UTSW 2 32,262,418 (GRCm39) missense probably damaging 1.00
R0816:Ciz1 UTSW 2 32,266,388 (GRCm39) unclassified probably benign
R1255:Ciz1 UTSW 2 32,255,888 (GRCm39) critical splice donor site probably null
R2116:Ciz1 UTSW 2 32,257,477 (GRCm39) missense probably damaging 0.99
R3161:Ciz1 UTSW 2 32,260,075 (GRCm39) missense probably benign 0.11
R3732:Ciz1 UTSW 2 32,257,495 (GRCm39) missense possibly damaging 0.68
R4014:Ciz1 UTSW 2 32,264,356 (GRCm39) missense probably damaging 0.96
R4386:Ciz1 UTSW 2 32,260,111 (GRCm39) missense possibly damaging 0.92
R4786:Ciz1 UTSW 2 32,267,539 (GRCm39) missense probably damaging 1.00
R4825:Ciz1 UTSW 2 32,261,753 (GRCm39) missense probably damaging 0.99
R4869:Ciz1 UTSW 2 32,254,247 (GRCm39) missense probably damaging 0.99
R4871:Ciz1 UTSW 2 32,262,300 (GRCm39) splice site probably benign
R5270:Ciz1 UTSW 2 32,264,511 (GRCm39) splice site probably null
R5429:Ciz1 UTSW 2 32,266,055 (GRCm39) missense possibly damaging 0.93
R5621:Ciz1 UTSW 2 32,261,753 (GRCm39) missense probably damaging 0.96
R5721:Ciz1 UTSW 2 32,266,052 (GRCm39) missense probably damaging 1.00
R5805:Ciz1 UTSW 2 32,257,408 (GRCm39) missense probably damaging 1.00
R5960:Ciz1 UTSW 2 32,261,228 (GRCm39) missense possibly damaging 0.85
R6187:Ciz1 UTSW 2 32,260,063 (GRCm39) missense possibly damaging 0.90
R6612:Ciz1 UTSW 2 32,267,323 (GRCm39) missense possibly damaging 0.93
R7006:Ciz1 UTSW 2 32,261,127 (GRCm39) critical splice donor site probably null
R7200:Ciz1 UTSW 2 32,254,299 (GRCm39) missense probably damaging 1.00
R7498:Ciz1 UTSW 2 32,261,761 (GRCm39) missense probably benign
R7574:Ciz1 UTSW 2 32,257,380 (GRCm39) missense probably benign 0.16
R7910:Ciz1 UTSW 2 32,260,139 (GRCm39) critical splice donor site probably null
R8390:Ciz1 UTSW 2 32,257,335 (GRCm39) missense probably benign 0.00
R8749:Ciz1 UTSW 2 32,255,848 (GRCm39) missense probably benign 0.03
R8765:Ciz1 UTSW 2 32,260,895 (GRCm39) missense probably damaging 0.99
R8784:Ciz1 UTSW 2 32,260,262 (GRCm39) missense probably benign 0.01
R8812:Ciz1 UTSW 2 32,254,286 (GRCm39) missense probably benign 0.00
R8927:Ciz1 UTSW 2 32,257,512 (GRCm39) nonsense probably null
R8928:Ciz1 UTSW 2 32,257,512 (GRCm39) nonsense probably null
R9681:Ciz1 UTSW 2 32,260,974 (GRCm39) missense possibly damaging 0.71
R9744:Ciz1 UTSW 2 32,253,859 (GRCm39) missense unknown
X0018:Ciz1 UTSW 2 32,261,264 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAACCCCTGATATAACCTTGACC -3'
(R):5'- ACAGAGCATGACTGAAGGCC -3'

Sequencing Primer
(F):5'- GACCATTCAATCATGTTATGACCTC -3'
(R):5'- CCAAAGGCCAGGGCAAGC -3'
Posted On 2015-10-21