Incidental Mutation 'R4687:Ciz1'
ID353720
Institutional Source Beutler Lab
Gene Symbol Ciz1
Ensembl Gene ENSMUSG00000039205
Gene NameCDKN1A interacting zinc finger protein 1
Synonyms0610038H21Rik, 2900056O04Rik
MMRRC Submission 041938-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4687 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32352327-32380970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32367465 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 174 (L174P)
Ref Sequence ENSEMBL: ENSMUSP00000116812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048964] [ENSMUST00000113331] [ENSMUST00000113332] [ENSMUST00000113334] [ENSMUST00000113338] [ENSMUST00000131152] [ENSMUST00000132028] [ENSMUST00000136079]
Predicted Effect probably damaging
Transcript: ENSMUST00000048964
AA Change: L174P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048428
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113331
AA Change: L150P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108957
Gene: ENSMUSG00000039205
AA Change: L150P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
low complexity region 221 232 N/A INTRINSIC
internal_repeat_2 252 284 9.48e-5 PROSPERO
internal_repeat_2 301 333 9.48e-5 PROSPERO
low complexity region 337 366 N/A INTRINSIC
ZnF_U1 510 544 1.23e-1 SMART
ZnF_C2H2 513 537 1.99e0 SMART
ZnF_U1 602 636 2.08e-1 SMART
ZnF_C2H2 605 629 3.02e0 SMART
low complexity region 665 685 N/A INTRINSIC
ZnF_U1 720 755 1.43e-4 SMART
ZnF_C2H2 723 748 9.56e1 SMART
low complexity region 799 821 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113332
AA Change: L174P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108958
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
ZnF_U1 480 514 1.23e-1 SMART
ZnF_C2H2 483 507 1.99e0 SMART
Blast:ZnF_U1 543 570 2e-6 BLAST
ZnF_U1 572 606 2.08e-1 SMART
ZnF_C2H2 575 599 3.02e0 SMART
low complexity region 635 655 N/A INTRINSIC
ZnF_U1 690 725 1.43e-4 SMART
ZnF_C2H2 693 718 9.56e1 SMART
low complexity region 769 791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113334
AA Change: L174P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108960
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113338
AA Change: L174P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108964
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125482
SMART Domains Protein: ENSMUSP00000120019
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
ZnF_C2H2 216 240 1.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125769
Predicted Effect probably benign
Transcript: ENSMUST00000131152
SMART Domains Protein: ENSMUSP00000141211
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132028
AA Change: L174P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120295
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132290
Predicted Effect probably damaging
Transcript: ENSMUST00000136079
AA Change: L174P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116812
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137220
Predicted Effect unknown
Transcript: ENSMUST00000139637
AA Change: L18P
SMART Domains Protein: ENSMUSP00000122469
Gene: ENSMUSG00000039205
AA Change: L18P

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
low complexity region 201 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192055
Predicted Effect probably benign
Transcript: ENSMUST00000151806
SMART Domains Protein: ENSMUSP00000119429
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice hoomozygous for a knock-out allele exhibit decreased body size and gender specific effects on motor phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 8,992,153 Y45N probably damaging Het
Agbl3 T C 6: 34,798,326 V189A probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Amn A T 12: 111,276,068 D439V probably benign Het
Arhgap17 T A 7: 123,321,603 D149V probably damaging Het
Atp6v0a4 A T 6: 38,092,465 I76N possibly damaging Het
Atp6v1h A T 1: 5,133,085 N291I probably damaging Het
Baiap2l2 G T 15: 79,259,253 P462T probably damaging Het
Bves C T 10: 45,354,840 probably null Het
Cabp7 T A 11: 4,739,265 K127* probably null Het
Cacna1h A G 17: 25,393,910 V313A possibly damaging Het
Camkk2 T C 5: 122,753,724 H245R probably damaging Het
Celsr1 T A 15: 85,932,460 S1761C possibly damaging Het
Cfap46 T C 7: 139,627,456 E1849G possibly damaging Het
Crim1 G T 17: 78,303,025 C303F probably damaging Het
Cyp26c1 A G 19: 37,692,937 Q396R probably damaging Het
Dnajc7 G A 11: 100,599,300 P43L probably damaging Het
Dpf2 T C 19: 5,907,012 H16R probably damaging Het
Dsp A G 13: 38,191,619 T1127A probably damaging Het
Dst T C 1: 34,201,123 L1525P probably damaging Het
Ehf T A 2: 103,267,126 D192V probably damaging Het
Frem1 G T 4: 83,020,631 N71K probably damaging Het
Furin T A 7: 80,393,447 T339S probably benign Het
Gad1 T A 2: 70,600,720 I569N possibly damaging Het
Gfi1 T C 5: 107,723,810 K10R probably damaging Het
Gm20775 T A Y: 10,641,258 noncoding transcript Homo
Gpn3 A C 5: 122,378,575 D89A possibly damaging Het
Gpr18 T A 14: 121,911,678 R312* probably null Het
Gsap T C 5: 21,246,971 probably benign Het
H2-Ab1 C A 17: 34,264,809 T48K probably damaging Het
Hmcn2 A T 2: 31,438,285 N4326I probably benign Het
Igkv4-51 A C 6: 69,681,730 probably benign Het
Insr T C 8: 3,161,709 H1104R probably benign Het
Ipo13 A T 4: 117,901,576 N697K probably benign Het
Iqcm T G 8: 75,762,989 F362V probably damaging Het
Irak4 T C 15: 94,566,823 S425P probably damaging Het
Jakmip2 T C 18: 43,577,412 E242G possibly damaging Het
Kdm4a T C 4: 118,144,083 K829R probably damaging Het
Kdr T C 5: 75,968,792 N145S possibly damaging Het
Klra9 A T 6: 130,185,517 D185E probably benign Het
Lcn12 T C 2: 25,493,321 N15S probably benign Het
Mei4 T A 9: 81,927,317 M151K probably damaging Het
Mmp3 T A 9: 7,451,223 S320T probably benign Het
Mrps5 C G 2: 127,590,770 A37G probably benign Het
Mttp A G 3: 138,092,735 I800T possibly damaging Het
Nags A T 11: 102,148,196 Q451L probably damaging Het
Nbea T C 3: 56,058,065 T476A probably damaging Het
Ndufb10 T C 17: 24,722,419 E145G possibly damaging Het
Neb T G 2: 52,304,035 S660R possibly damaging Het
Nppb A G 4: 147,986,296 K43E probably benign Het
Nup188 A T 2: 30,330,633 Q906L probably benign Het
Olfr1259 T C 2: 89,943,869 D82G probably damaging Het
Olfr1413 T C 1: 92,573,330 I53T possibly damaging Het
Olfr370 T A 8: 83,541,860 S239T probably damaging Het
Olfr895 C A 9: 38,269,414 N292K probably damaging Het
Ovch2 T A 7: 107,796,548 I88F possibly damaging Het
Palm3 A G 8: 84,029,935 E692G probably benign Het
Pcsk6 T C 7: 65,983,753 F578L probably damaging Het
Piezo2 A C 18: 63,069,963 D1535E probably damaging Het
Ppp1r15b T C 1: 133,132,135 V130A probably benign Het
Proca1 T C 11: 78,204,898 Y32H probably damaging Het
Prtg T A 9: 72,890,798 V682E probably damaging Het
Pyroxd1 A T 6: 142,361,868 M455L probably benign Het
Rasa1 T C 13: 85,226,635 D739G possibly damaging Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Sepsecs T C 5: 52,643,871 D483G probably benign Het
Setd7 T C 3: 51,550,355 D17G probably damaging Het
Sipa1l2 C T 8: 125,491,245 C451Y probably damaging Het
Slc31a1 A G 4: 62,388,702 Y165C probably damaging Het
Smg5 T C 3: 88,342,469 F68L possibly damaging Het
Sptbn5 A G 2: 120,077,208 probably benign Het
Stk3 A G 15: 35,114,565 I65T probably damaging Het
Tas2r115 C T 6: 132,737,284 A235T possibly damaging Het
Tenm2 C T 11: 36,049,097 A1400T probably benign Het
Tet1 T A 10: 62,838,791 N1169Y probably benign Het
Treml2 T A 17: 48,309,397 probably null Het
Tspan11 A G 6: 127,938,235 E104G probably damaging Het
Wdtc1 G A 4: 133,296,431 A543V probably damaging Het
Zfp148 T A 16: 33,496,819 D578E probably damaging Het
Zfp735 A T 11: 73,711,855 N542Y probably damaging Het
Zfp735 A T 11: 73,711,856 N542I probably damaging Het
Zfp869 T A 8: 69,708,143 E65D probably benign Het
Other mutations in Ciz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Ciz1 APN 2 32372388 missense probably damaging 1.00
IGL01872:Ciz1 APN 2 32378109 utr 3 prime probably benign
R0029:Ciz1 UTSW 2 32371419 splice site probably benign
R0122:Ciz1 UTSW 2 32371419 splice site probably benign
R0363:Ciz1 UTSW 2 32377363 critical splice donor site probably null
R0373:Ciz1 UTSW 2 32367467 missense probably damaging 1.00
R0653:Ciz1 UTSW 2 32372406 missense probably damaging 1.00
R0816:Ciz1 UTSW 2 32376376 unclassified probably benign
R1255:Ciz1 UTSW 2 32365876 critical splice donor site probably null
R2116:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R3161:Ciz1 UTSW 2 32370063 missense probably benign 0.11
R3732:Ciz1 UTSW 2 32367483 missense possibly damaging 0.68
R4014:Ciz1 UTSW 2 32374344 missense probably damaging 0.96
R4386:Ciz1 UTSW 2 32370099 missense possibly damaging 0.92
R4786:Ciz1 UTSW 2 32377527 missense probably damaging 1.00
R4825:Ciz1 UTSW 2 32371741 missense probably damaging 0.99
R4869:Ciz1 UTSW 2 32364235 missense probably damaging 0.99
R4871:Ciz1 UTSW 2 32372288 splice site probably benign
R5270:Ciz1 UTSW 2 32374499 splice site probably null
R5429:Ciz1 UTSW 2 32376043 missense possibly damaging 0.93
R5621:Ciz1 UTSW 2 32371741 missense probably damaging 0.96
R5721:Ciz1 UTSW 2 32376040 missense probably damaging 1.00
R5805:Ciz1 UTSW 2 32367396 missense probably damaging 1.00
R5960:Ciz1 UTSW 2 32371216 missense possibly damaging 0.85
R6187:Ciz1 UTSW 2 32370051 missense possibly damaging 0.90
R6612:Ciz1 UTSW 2 32377311 missense possibly damaging 0.93
R7006:Ciz1 UTSW 2 32371115 critical splice donor site probably null
R7200:Ciz1 UTSW 2 32364287 missense probably damaging 1.00
R7498:Ciz1 UTSW 2 32371749 missense probably benign
R7574:Ciz1 UTSW 2 32367368 missense probably benign 0.16
R7910:Ciz1 UTSW 2 32370127 critical splice donor site probably null
R8390:Ciz1 UTSW 2 32367323 missense probably benign 0.00
R8749:Ciz1 UTSW 2 32365836 missense probably benign 0.03
R8765:Ciz1 UTSW 2 32370883 missense probably damaging 0.99
R8784:Ciz1 UTSW 2 32370250 missense probably benign 0.01
R8812:Ciz1 UTSW 2 32364274 missense probably benign 0.00
X0018:Ciz1 UTSW 2 32371252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAACCCCTGATATAACCTTGACC -3'
(R):5'- ACAGAGCATGACTGAAGGCC -3'

Sequencing Primer
(F):5'- GACCATTCAATCATGTTATGACCTC -3'
(R):5'- CCAAAGGCCAGGGCAAGC -3'
Posted On2015-10-21