Incidental Mutation 'R6214:Gm8890'
ID503611
Institutional Source Beutler Lab
Gene Symbol Gm8890
Ensembl Gene ENSMUSG00000096846
Gene Namepredicted gene 8890
Synonyms
MMRRC Submission 044347-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6214 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location11256033-11260494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11257230 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 25 (T25I)
Ref Sequence ENSEMBL: ENSMUSP00000136387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177727]
Predicted Effect unknown
Transcript: ENSMUST00000164262
AA Change: T27I
SMART Domains Protein: ENSMUSP00000127049
Gene: ENSMUSG00000096846
AA Change: T27I

DomainStartEndE-ValueType
Pfam:Takusan 6 92 4.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177727
AA Change: T25I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136387
Gene: ENSMUSG00000096846
AA Change: T25I

DomainStartEndE-ValueType
Pfam:Takusan 2 90 4.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197751
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A C 4: 136,241,425 D727A possibly damaging Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Atp13a5 T C 16: 29,251,407 Y909C probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Cntrl A G 2: 35,129,634 E491G probably benign Het
Ctdnep1 T C 11: 69,989,508 F206L probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Eif4g3 C T 4: 138,058,003 H137Y probably damaging Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Glra3 A G 8: 55,991,256 probably null Het
Gm15448 A G 7: 3,821,718 I554T probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lrrc9 A T 12: 72,459,853 E301D probably damaging Het
Ms4a6c T C 19: 11,471,136 I11T possibly damaging Het
Myo1d A T 11: 80,779,791 M1K probably null Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Spen C T 4: 141,479,112 E735K unknown Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Vsig10 G A 5: 117,343,924 C393Y probably damaging Het
Ywhag A G 5: 135,911,074 I222T probably damaging Het
Other mutations in Gm8890
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02298:Gm8890 APN 5 11257191 missense probably damaging 0.99
R6215:Gm8890 UTSW 5 11257230 missense probably damaging 0.99
R6511:Gm8890 UTSW 5 11257308 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCATGTGGAGGCATCTCAAG -3'
(R):5'- GGGACAATCTGGTGGTACAG -3'

Sequencing Primer
(F):5'- GCCCAGAACAAACTCTTTCTGGTG -3'
(R):5'- GTGGTACAGCTTCATAGAACCC -3'
Posted On2018-02-27