Incidental Mutation 'R6214:Chia1'
ID503607
Institutional Source Beutler Lab
Gene Symbol Chia1
Ensembl Gene ENSMUSG00000062778
Gene Namechitinase, acidic 1
Synonyms2200003E03Rik, YNL, AMCase, Chia
MMRRC Submission 044347-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R6214 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location106113229-106132120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106122445 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 132 (F132L)
Ref Sequence ENSEMBL: ENSMUSP00000078134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079132] [ENSMUST00000139086]
Predicted Effect probably damaging
Transcript: ENSMUST00000079132
AA Change: F132L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078134
Gene: ENSMUSG00000062778
AA Change: F132L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.82e-161 SMART
ChtBD2 425 473 2.06e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139086
AA Change: F72L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121967
Gene: ENSMUSG00000062778
AA Change: F72L

DomainStartEndE-ValueType
Glyco_18 3 215 2.24e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143128
Meta Mutation Damage Score 0.6944 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A C 4: 136,241,425 D727A possibly damaging Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Atp13a5 T C 16: 29,251,407 Y909C probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Cntrl A G 2: 35,129,634 E491G probably benign Het
Ctdnep1 T C 11: 69,989,508 F206L probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Eif4g3 C T 4: 138,058,003 H137Y probably damaging Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Glra3 A G 8: 55,991,256 probably null Het
Gm15448 A G 7: 3,821,718 I554T probably damaging Het
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lrrc9 A T 12: 72,459,853 E301D probably damaging Het
Ms4a6c T C 19: 11,471,136 I11T possibly damaging Het
Myo1d A T 11: 80,779,791 M1K probably null Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Spen C T 4: 141,479,112 E735K unknown Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Vsig10 G A 5: 117,343,924 C393Y probably damaging Het
Ywhag A G 5: 135,911,074 I222T probably damaging Het
Other mutations in Chia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01917:Chia1 APN 3 106128220 missense probably damaging 1.00
Pet UTSW 3 106129022 critical splice donor site probably null
R0004:Chia1 UTSW 3 106129009 missense probably damaging 1.00
R0011:Chia1 UTSW 3 106130974 unclassified probably benign
R0047:Chia1 UTSW 3 106115257 missense probably damaging 0.99
R0345:Chia1 UTSW 3 106122439 missense probably damaging 1.00
R0456:Chia1 UTSW 3 106128479 missense probably damaging 1.00
R0638:Chia1 UTSW 3 106128437 splice site probably benign
R0847:Chia1 UTSW 3 106131937 missense probably benign 0.12
R1055:Chia1 UTSW 3 106130883 missense probably damaging 1.00
R1401:Chia1 UTSW 3 106128939 missense probably benign 0.00
R1513:Chia1 UTSW 3 106131904 missense probably benign 0.44
R1846:Chia1 UTSW 3 106130865 missense probably damaging 0.98
R1882:Chia1 UTSW 3 106128474 missense probably damaging 1.00
R1914:Chia1 UTSW 3 106128559 missense probably benign 0.06
R1915:Chia1 UTSW 3 106128559 missense probably benign 0.06
R2107:Chia1 UTSW 3 106128840 nonsense probably null
R3969:Chia1 UTSW 3 106121635 splice site probably null
R3970:Chia1 UTSW 3 106121635 splice site probably null
R4112:Chia1 UTSW 3 106128528 missense probably damaging 1.00
R4432:Chia1 UTSW 3 106115325 missense probably benign 0.03
R4625:Chia1 UTSW 3 106128940 missense probably benign 0.00
R4748:Chia1 UTSW 3 106122449 missense probably damaging 1.00
R5805:Chia1 UTSW 3 106128476 missense probably damaging 0.98
R5906:Chia1 UTSW 3 106131988 missense probably benign 0.01
R6173:Chia1 UTSW 3 106129022 critical splice donor site probably null
R6215:Chia1 UTSW 3 106122445 missense probably damaging 1.00
R6225:Chia1 UTSW 3 106130897 missense possibly damaging 0.66
R6383:Chia1 UTSW 3 106131811 missense probably benign
R6423:Chia1 UTSW 3 106128988 missense possibly damaging 0.60
R6668:Chia1 UTSW 3 106130948 missense probably damaging 1.00
R6764:Chia1 UTSW 3 106130740 critical splice donor site probably null
R7030:Chia1 UTSW 3 106115325 missense probably damaging 1.00
R7221:Chia1 UTSW 3 106131920 missense probably damaging 1.00
R7265:Chia1 UTSW 3 106128923 missense probably damaging 1.00
R7343:Chia1 UTSW 3 106132015 makesense probably null
R7420:Chia1 UTSW 3 106130664 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGCTGAGGTACTGTGGC -3'
(R):5'- CAAGCACCTGGTCCTCATTG -3'

Sequencing Primer
(F):5'- GGATAGCCCTGGAATACACTTTAGTC -3'
(R):5'- AGAGATGCTTGTCCTGAG -3'
Posted On2018-02-27