Incidental Mutation 'R6233:Eif2ak2'
ID504790
Institutional Source Beutler Lab
Gene Symbol Eif2ak2
Ensembl Gene ENSMUSG00000024079
Gene Nameeukaryotic translation initiation factor 2-alpha kinase 2
SynonymsdsRNA-activated kinase, eIF-2 alpha, eIF-2 alpha, IFN- type I-induced and dsRNA-activated kinase, IFN-induced and double-stranded RNA-activated kinase, Pkr, Prkr, Tik
MMRRC Submission 044361-MU
Accession Numbers

Genbank: NM_011163; MGI: 1353449

Is this an essential gene? Possibly essential (E-score: 0.627) question?
Stock #R6233 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location78852564-78882573 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 78871233 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 137 (Y137*)
Ref Sequence ENSEMBL: ENSMUSP00000024884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024884]
PDB Structure
Solution structure of the second DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Solution structure of the first DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000024884
AA Change: Y137*
SMART Domains Protein: ENSMUSP00000024884
Gene: ENSMUSG00000024079
AA Change: Y137*

DomainStartEndE-ValueType
DSRM 9 75 2.34e-20 SMART
DSRM 96 161 7.66e-16 SMART
low complexity region 169 196 N/A INTRINSIC
Pfam:Pkinase 242 500 4.6e-56 PFAM
Pfam:Pkinase_Tyr 242 500 8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171852
Meta Mutation Damage Score 0.9571 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display altered susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(2) Gene trapped(5)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,965 T300A probably benign Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acvr1 T A 2: 58,448,399 N437I probably benign Het
Adgrg7 T A 16: 56,778,642 T57S possibly damaging Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
AI481877 T A 4: 59,076,245 D566V possibly damaging Het
Ankrd9 A T 12: 110,977,120 I160N probably damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Clmn A C 12: 104,785,455 L247R probably damaging Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dmkn C A 7: 30,779,679 A280E probably damaging Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsc3 C T 18: 19,965,795 G776R possibly damaging Het
Eefsec A G 6: 88,358,544 probably null Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eny2 A G 15: 44,433,660 probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fbxo28 A G 1: 182,341,508 S22P unknown Het
Fcrlb A G 1: 170,908,889 I106T probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm4756 T C 12: 72,619,567 Y110C probably damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Gm884 A T 11: 103,613,388 L2585I probably damaging Het
Gna12 A G 5: 140,760,692 F333L possibly damaging Het
Gria2 A G 3: 80,707,203 I510T probably damaging Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Il1rap A G 16: 26,710,506 T310A probably benign Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kcnk4 T C 19: 6,928,329 N90S probably benign Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Lamc1 A T 1: 153,223,666 D1520E probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myh7b C T 2: 155,631,799 A1584V possibly damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr1474 T C 19: 13,471,740 Y257H probably damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Olfr799 T C 10: 129,647,296 M56T probably benign Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pilra T C 5: 137,823,501 T291A possibly damaging Het
Ppp1r9a G T 6: 5,077,610 D630Y probably damaging Het
Pros1 A C 16: 62,898,921 Q102P possibly damaging Het
Rad21l T C 2: 151,653,542 D407G probably benign Het
Rapgef5 G A 12: 117,739,718 probably null Het
Rbm25 G A 12: 83,659,426 A182T probably benign Het
Rnf13 A G 3: 57,832,970 E236G possibly damaging Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Sdr16c6 T A 4: 4,069,984 I119F probably damaging Het
Slc12a7 T C 13: 73,805,471 S767P possibly damaging Het
Slc23a1 A G 18: 35,624,444 I258T probably damaging Het
Spata13 G A 14: 60,692,007 R338H probably benign Het
Sufu G A 19: 46,475,632 G428R probably damaging Het
Sult2a1 T C 7: 13,832,675 D125G probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tenm3 A C 8: 48,417,059 V233G probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tspan11 T C 6: 127,938,264 Y114H probably damaging Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Usp44 G A 10: 93,850,340 C539Y probably damaging Het
Vmn2r73 G A 7: 85,869,891 P508S probably benign Het
Zfp831 A G 2: 174,646,697 D1055G possibly damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Eif2ak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Eif2ak2 APN 17 78869483 missense probably benign 0.00
IGL01017:Eif2ak2 APN 17 78863858 missense probably damaging 1.00
IGL01068:Eif2ak2 APN 17 78865371 missense probably damaging 1.00
3-1:Eif2ak2 UTSW 17 78869498 missense probably benign 0.00
R0038:Eif2ak2 UTSW 17 78863955 missense probably benign
R0801:Eif2ak2 UTSW 17 78866349 nonsense probably null
R1702:Eif2ak2 UTSW 17 78856634 missense probably damaging 1.00
R2020:Eif2ak2 UTSW 17 78863963 missense possibly damaging 0.87
R2159:Eif2ak2 UTSW 17 78874018 missense possibly damaging 0.77
R3405:Eif2ak2 UTSW 17 78858639 splice site probably benign
R3406:Eif2ak2 UTSW 17 78858639 splice site probably benign
R4355:Eif2ak2 UTSW 17 78858534 missense probably benign 0.08
R5135:Eif2ak2 UTSW 17 78866345 missense probably damaging 0.96
R5145:Eif2ak2 UTSW 17 78876204 missense possibly damaging 0.60
R5336:Eif2ak2 UTSW 17 78874043 missense probably benign 0.00
R6195:Eif2ak2 UTSW 17 78871233 nonsense probably null
R6417:Eif2ak2 UTSW 17 78856619 missense probably damaging 1.00
R6737:Eif2ak2 UTSW 17 78863948 missense probably benign 0.00
R7108:Eif2ak2 UTSW 17 78858536 nonsense probably null
R7238:Eif2ak2 UTSW 17 78866331 missense probably benign 0.01
R7830:Eif2ak2 UTSW 17 78866403 missense probably damaging 1.00
R7843:Eif2ak2 UTSW 17 78868774 missense probably benign 0.24
R7845:Eif2ak2 UTSW 17 78863898 missense probably damaging 1.00
R8003:Eif2ak2 UTSW 17 78876223 missense probably damaging 0.99
R8143:Eif2ak2 UTSW 17 78858532 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCCCGCAGTATAAAGACAAAG -3'
(R):5'- GACAAGGATATAAGCTACTCCTGG -3'

Sequencing Primer
(F):5'- GCAATCTGAAGTCAATTTCAAAGGG -3'
(R):5'- ACATTAGATTGATGGCCATTTTGTG -3'
Posted On2018-02-28