Incidental Mutation 'R6243:Araf'
ID505415
Institutional Source Beutler Lab
Gene Symbol Araf
Ensembl Gene ENSMUSG00000001127
Gene NameAraf proto-oncogene, serine/threonine kinase
Synonyms1200013E08Rik, Araf1, A-Raf
MMRRC Submission 044365-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R6243 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location20797814-20860519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20860100 bp
ZygosityHomozygous
Amino Acid Change Arginine to Leucine at position 601 (R601L)
Ref Sequence ENSEMBL: ENSMUSP00000001155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001155] [ENSMUST00000081893] [ENSMUST00000115345] [ENSMUST00000136451]
Predicted Effect probably damaging
Transcript: ENSMUST00000001155
AA Change: R601L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001155
Gene: ENSMUSG00000001127
AA Change: R601L

DomainStartEndE-ValueType
RBD 19 91 1.46e-28 SMART
C1 99 144 7.68e-12 SMART
low complexity region 243 268 N/A INTRINSIC
Pfam:Pkinase_Tyr 308 565 1.9e-61 PFAM
Pfam:Pkinase 308 566 1.7e-56 PFAM
Pfam:Kinase-like 388 555 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081893
SMART Domains Protein: ENSMUSP00000080568
Gene: ENSMUSG00000037217

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 1.3e-23 PFAM
low complexity region 87 94 N/A INTRINSIC
Pfam:Synapsin 111 212 7.8e-47 PFAM
Pfam:Synapsin_C 214 416 3.2e-124 PFAM
low complexity region 427 440 N/A INTRINSIC
low complexity region 450 491 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 579 600 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115345
SMART Domains Protein: ENSMUSP00000111002
Gene: ENSMUSG00000037217

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 1.3e-23 PFAM
low complexity region 87 94 N/A INTRINSIC
Pfam:Synapsin 110 212 3.2e-60 PFAM
Pfam:Synapsin_C 214 416 1.1e-132 PFAM
Pfam:RimK 229 409 3.3e-8 PFAM
low complexity region 427 440 N/A INTRINSIC
low complexity region 450 491 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 579 600 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128250
AA Change: R199L
SMART Domains Protein: ENSMUSP00000119544
Gene: ENSMUSG00000001127
AA Change: R199L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 109 3.8e-15 PFAM
Pfam:Pkinase 16 109 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136451
SMART Domains Protein: ENSMUSP00000115793
Gene: ENSMUSG00000001127

DomainStartEndE-ValueType
RBD 56 128 1.46e-28 SMART
C1 136 181 7.68e-12 SMART
low complexity region 280 305 N/A INTRINSIC
Pfam:Pkinase_Tyr 345 401 2.3e-7 PFAM
Pfam:Pkinase 345 403 7.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176786
Meta Mutation Damage Score 0.1142 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene belongs to the RAF subfamily of the Ser/Thr protein kinase family, and maybe involved in cell growth and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous females or hemizygous males for a null targeted mutation show variable genetic background effects, from preweaning death, wasting, tremors, distended colon and small thymus to normal survival and breeding with mild neurological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,314,301 S331P probably damaging Het
Akap9 T G 5: 4,065,000 probably null Het
Ankef1 A G 2: 136,537,157 E9G probably damaging Het
Ap1g2 T C 14: 55,099,073 E788G probably benign Het
Asrgl1 A T 19: 9,116,504 I220K probably damaging Het
Atg16l2 A C 7: 101,292,329 *404E probably null Het
Atp4a T C 7: 30,715,957 F334S possibly damaging Het
Atp6v0d1 T C 8: 105,565,863 E17G probably benign Het
Bcat2 T C 7: 45,588,267 V279A probably benign Het
Birc6 T G 17: 74,609,387 M459R probably damaging Het
Bsn T C 9: 108,107,561 Y3098C unknown Het
Btaf1 T A 19: 36,981,120 M679K probably benign Het
Col6a4 T C 9: 106,013,390 T1902A possibly damaging Het
Crhr1 G A 11: 104,173,914 C364Y probably damaging Het
Crmp1 T C 5: 37,288,944 L648P probably damaging Het
Cyfip1 T C 7: 55,900,529 Y671H probably damaging Het
Cyp2b13 C T 7: 26,061,619 P34S probably damaging Het
Dnajb6 T A 5: 29,781,133 V233E probably benign Het
Dnhd1 A T 7: 105,652,009 H191L probably damaging Het
Dsg3 T A 18: 20,539,724 D817E probably damaging Het
Dytn T C 1: 63,647,521 Q330R possibly damaging Het
Fads1 G T 19: 10,185,727 E123* probably null Het
Fchsd2 T C 7: 101,271,809 probably benign Het
Fmo9 T C 1: 166,667,369 E270G probably benign Het
Folr1 T A 7: 101,863,965 H41L probably damaging Het
Gm29776 T A 14: 54,695,759 R322S probably damaging Het
Gm7298 A G 6: 121,779,137 N985S possibly damaging Het
Gp1ba T C 11: 70,640,137 probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Igf2bp3 A T 6: 49,107,428 N285K possibly damaging Het
Lca5l G A 16: 96,178,912 T6I possibly damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mpeg1 A G 19: 12,462,240 H354R probably benign Het
Msh6 T A 17: 87,983,571 V195E possibly damaging Het
Mtfmt C T 9: 65,443,900 T243I probably benign Het
Myo1h T A 5: 114,362,147 I195K probably damaging Het
Nr1h5 T C 3: 102,949,064 K300E probably benign Het
Nuak2 T C 1: 132,332,367 S628P probably benign Het
Nup214 G T 2: 32,002,932 A721S possibly damaging Het
Olfr1148 A G 2: 87,833,041 M1V probably null Het
Olfr74 A G 2: 87,974,587 V26A probably benign Het
Pclo T C 5: 14,676,443 probably benign Het
Phf20 A G 2: 156,223,400 S12G probably benign Het
Pik3r5 T C 11: 68,492,000 Y289H probably damaging Het
Pld1 T C 3: 28,095,805 I717T probably damaging Het
Plxdc1 A G 11: 97,955,473 Y182H probably damaging Het
Ppid A G 3: 79,603,066 I354V probably benign Het
Prss2 T C 6: 41,524,453 V152A probably benign Het
Rab28 C T 5: 41,635,880 A141T probably benign Het
Rabgap1l C T 1: 160,645,307 probably null Het
Rabl6 T G 2: 25,585,403 S553R probably damaging Het
Rars A G 11: 35,826,547 F170S possibly damaging Het
Ror2 T A 13: 53,113,080 M440L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph4a A T 10: 33,909,143 Q350L probably damaging Het
Serpinb2 T C 1: 107,523,139 F204L probably damaging Het
Sertad4 T C 1: 192,850,949 probably null Het
Shisa3 C T 5: 67,611,143 P129S probably benign Het
Slc13a2 G A 11: 78,404,708 L111F probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Stab2 T A 10: 86,907,161 R1195W probably damaging Het
Syna C A 5: 134,560,114 probably benign Het
Thada A T 17: 84,436,602 D759E probably benign Het
Thoc5 A G 11: 4,919,753 Y385C possibly damaging Het
Thsd7a C T 6: 12,327,602 D1424N probably damaging Het
Thsd7b A T 1: 130,162,862 Q1204L probably benign Het
Tnfrsf8 T C 4: 145,303,101 N43S possibly damaging Het
Trim66 T C 7: 109,460,274 K921R probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ugt2a2 T G 5: 87,462,959 K339N probably benign Het
Vmn2r8 T C 5: 108,799,345 T514A probably benign Het
Wrn A T 8: 33,284,654 M652K possibly damaging Het
Yme1l1 A T 2: 23,193,172 Y550F probably benign Het
Zfp995 G A 17: 21,880,288 P322S probably damaging Het
Other mutations in Araf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02244:Araf APN X 20853596 splice site probably benign
IGL02484:Araf APN X 20853909 splice site probably benign
R1496:Araf UTSW X 20859704 missense probably damaging 1.00
R2228:Araf UTSW X 20851673 missense probably benign 0.30
R3732:Araf UTSW X 20850226 critical splice acceptor site probably benign
R6193:Araf UTSW X 20860100 missense probably damaging 0.98
R6194:Araf UTSW X 20860100 missense probably damaging 0.98
R6195:Araf UTSW X 20860100 missense probably damaging 0.98
R6242:Araf UTSW X 20860100 missense probably damaging 0.98
R6244:Araf UTSW X 20860100 missense probably damaging 0.98
R6274:Araf UTSW X 20860100 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTCTGGGACTCTGGACAC -3'
(R):5'- GCCATTGGAGATAAAACAGCTCTC -3'

Sequencing Primer
(F):5'- TGGGACTCTGGACACCCCTC -3'
(R):5'- GAGAAAGCAGGAGACCTCAGTTTTTG -3'
Posted On2018-02-28