Mutagenetix > Incidental Mutations

Incidental Mutation 'R6243:Uaca'

505388

Institutional Source

Beutler Lab

Gene Symbol

Uaca

Ensembl Gene

ENSMUSG00000034485

Gene Name

uveal autoantigen with coiled-coil domains and ankyrin repeats

Synonyms

2700059D02Rik, nucling

MMRRC Submission

044365-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R6243 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60794542-60880370 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 60870044 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 571 (R571Q)

Ref Sequence

ENSEMBL: ENSMUSP00000062047 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050183
AA Change: R571Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: R571Q

Domain	Start	End	E-Value	Type
low complexity region	13	31	N/A	INTRINSIC
ANK	35	68	2.66e3	SMART
ANK	69	98	1.96e-3	SMART
ANK	102	131	1.65e-1	SMART
ANK	135	164	1.38e-3	SMART
ANK	168	197	3.65e-3	SMART
ANK	201	230	6.26e-2	SMART
Blast:ANK	234	263	7e-9	BLAST
coiled coil region	301	381	N/A	INTRINSIC
coiled coil region	445	626	N/A	INTRINSIC
Pfam:TolA_bind_tri	869	943	4e-11	PFAM
coiled coil region	1009	1382	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214354
AA Change: R569Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214997

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216574

Predicted Effect

probably benign
Transcript: ENSMUST00000217656

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (73/74)

MGI Phenotype

PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	T	C	13: 104,314,301	S331P	probably damaging	Het
Akap9	T	G	5: 4,065,000		probably null	Het
Ankef1	A	G	2: 136,537,157	E9G	probably damaging	Het
Ap1g2	T	C	14: 55,099,073	E788G	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Asrgl1	A	T	19: 9,116,504	I220K	probably damaging	Het
Atg16l2	A	C	7: 101,292,329	*404E	probably null	Het
Atp4a	T	C	7: 30,715,957	F334S	possibly damaging	Het
Atp6v0d1	T	C	8: 105,565,863	E17G	probably benign	Het
Bcat2	T	C	7: 45,588,267	V279A	probably benign	Het
Birc6	T	G	17: 74,609,387	M459R	probably damaging	Het
Bsn	T	C	9: 108,107,561	Y3098C	unknown	Het
Btaf1	T	A	19: 36,981,120	M679K	probably benign	Het
Col6a4	T	C	9: 106,013,390	T1902A	possibly damaging	Het
Crhr1	G	A	11: 104,173,914	C364Y	probably damaging	Het
Crmp1	T	C	5: 37,288,944	L648P	probably damaging	Het
Cyfip1	T	C	7: 55,900,529	Y671H	probably damaging	Het
Cyp2b13	C	T	7: 26,061,619	P34S	probably damaging	Het
Dnajb6	T	A	5: 29,781,133	V233E	probably benign	Het
Dnhd1	A	T	7: 105,652,009	H191L	probably damaging	Het
Dsg3	T	A	18: 20,539,724	D817E	probably damaging	Het
Dytn	T	C	1: 63,647,521	Q330R	possibly damaging	Het
Fads1	G	T	19: 10,185,727	E123*	probably null	Het
Fchsd2	T	C	7: 101,271,809		probably benign	Het
Fmo9	T	C	1: 166,667,369	E270G	probably benign	Het
Folr1	T	A	7: 101,863,965	H41L	probably damaging	Het
Gm29776	T	A	14: 54,695,759	R322S	probably damaging	Het
Gm7298	A	G	6: 121,779,137	N985S	possibly damaging	Het
Gp1ba	T	C	11: 70,640,137		probably benign	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Igf2bp3	A	T	6: 49,107,428	N285K	possibly damaging	Het
Lca5l	G	A	16: 96,178,912	T6I	possibly damaging	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Mpeg1	A	G	19: 12,462,240	H354R	probably benign	Het
Msh6	T	A	17: 87,983,571	V195E	possibly damaging	Het
Mtfmt	C	T	9: 65,443,900	T243I	probably benign	Het
Myo1h	T	A	5: 114,362,147	I195K	probably damaging	Het
Nr1h5	T	C	3: 102,949,064	K300E	probably benign	Het
Nuak2	T	C	1: 132,332,367	S628P	probably benign	Het
Nup214	G	T	2: 32,002,932	A721S	possibly damaging	Het
Olfr1148	A	G	2: 87,833,041	M1V	probably null	Het
Olfr74	A	G	2: 87,974,587	V26A	probably benign	Het
Pclo	T	C	5: 14,676,443		probably benign	Het
Phf20	A	G	2: 156,223,400	S12G	probably benign	Het
Pik3r5	T	C	11: 68,492,000	Y289H	probably damaging	Het
Pld1	T	C	3: 28,095,805	I717T	probably damaging	Het
Plxdc1	A	G	11: 97,955,473	Y182H	probably damaging	Het
Ppid	A	G	3: 79,603,066	I354V	probably benign	Het
Prss2	T	C	6: 41,524,453	V152A	probably benign	Het
Rab28	C	T	5: 41,635,880	A141T	probably benign	Het
Rabgap1l	C	T	1: 160,645,307		probably null	Het
Rabl6	T	G	2: 25,585,403	S553R	probably damaging	Het
Rars	A	G	11: 35,826,547	F170S	possibly damaging	Het
Ror2	T	A	13: 53,113,080	M440L	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Rsph4a	A	T	10: 33,909,143	Q350L	probably damaging	Het
Serpinb2	T	C	1: 107,523,139	F204L	probably damaging	Het
Sertad4	T	C	1: 192,850,949		probably null	Het
Shisa3	C	T	5: 67,611,143	P129S	probably benign	Het
Slc13a2	G	A	11: 78,404,708	L111F	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Stab2	T	A	10: 86,907,161	R1195W	probably damaging	Het
Syna	C	A	5: 134,560,114		probably benign	Het
Thada	A	T	17: 84,436,602	D759E	probably benign	Het
Thoc5	A	G	11: 4,919,753	Y385C	possibly damaging	Het
Thsd7a	C	T	6: 12,327,602	D1424N	probably damaging	Het
Thsd7b	A	T	1: 130,162,862	Q1204L	probably benign	Het
Tnfrsf8	T	C	4: 145,303,101	N43S	possibly damaging	Het
Trim66	T	C	7: 109,460,274	K921R	probably benign	Het
Ugt2a2	T	G	5: 87,462,959	K339N	probably benign	Het
Vmn2r8	T	C	5: 108,799,345	T514A	probably benign	Het
Wrn	A	T	8: 33,284,654	M652K	possibly damaging	Het
Yme1l1	A	T	2: 23,193,172	Y550F	probably benign	Het
Zfp995	G	A	17: 21,880,288	P322S	probably damaging	Het

Other mutations in Uaca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Uaca	APN	9	60872225	missense	probably benign
IGL01751:Uaca	APN	9	60869857	missense	probably damaging	1.00
IGL02868:Uaca	APN	9	60863637	missense	probably damaging	1.00
IGL02977:Uaca	APN	9	60866380	missense	probably benign	0.00
IGL03037:Uaca	APN	9	60840865	missense	probably damaging	1.00
IGL03060:Uaca	APN	9	60869866	missense	probably damaging	1.00
IGL03083:Uaca	APN	9	60863663	missense	probably benign	0.28
IGL03266:Uaca	APN	9	60863407	missense	probably damaging	1.00
IGL03346:Uaca	APN	9	60854318	missense	probably damaging	1.00
Ixtapa	UTSW	9	60870413	missense	probably damaging	0.99
oaxaca	UTSW	9	60871451	missense	probably benign
R0408:Uaca	UTSW	9	60871859	missense	possibly damaging	0.71
R0567:Uaca	UTSW	9	60871381	missense	probably benign	0.01
R0598:Uaca	UTSW	9	60870921	nonsense	probably null
R0603:Uaca	UTSW	9	60871097	missense	possibly damaging	0.60
R0655:Uaca	UTSW	9	60872029	missense	probably benign	0.03
R0707:Uaca	UTSW	9	60848618	splice site	probably benign
R0791:Uaca	UTSW	9	60872059	missense	possibly damaging	0.50
R1466:Uaca	UTSW	9	60854321	missense	possibly damaging	0.88
R1466:Uaca	UTSW	9	60854321	missense	possibly damaging	0.88
R1520:Uaca	UTSW	9	60871381	missense	probably benign	0.30
R1673:Uaca	UTSW	9	60872156	missense	probably damaging	1.00
R1894:Uaca	UTSW	9	60870436	missense	possibly damaging	0.87
R1997:Uaca	UTSW	9	60870341	missense	probably damaging	1.00
R2042:Uaca	UTSW	9	60869891	missense	probably damaging	1.00
R2095:Uaca	UTSW	9	60840843	missense	probably benign	0.00
R2148:Uaca	UTSW	9	60869679	missense	probably damaging	1.00
R2384:Uaca	UTSW	9	60869917	missense	probably damaging	1.00
R3110:Uaca	UTSW	9	60871499	missense	probably damaging	1.00
R3112:Uaca	UTSW	9	60871499	missense	probably damaging	1.00
R4001:Uaca	UTSW	9	60871084	missense	probably benign	0.04
R4155:Uaca	UTSW	9	60871753	missense	probably benign	0.02
R4156:Uaca	UTSW	9	60871753	missense	probably benign	0.02
R4157:Uaca	UTSW	9	60871753	missense	probably benign	0.02
R4410:Uaca	UTSW	9	60869891	missense	probably damaging	1.00
R4674:Uaca	UTSW	9	60854429	missense	possibly damaging	0.94
R4871:Uaca	UTSW	9	60846001	missense	probably damaging	1.00
R5130:Uaca	UTSW	9	60880228	missense	probably damaging	0.96
R5328:Uaca	UTSW	9	60870532	missense	probably benign	0.44
R5358:Uaca	UTSW	9	60871148	missense	probably benign
R5415:Uaca	UTSW	9	60870139	missense	possibly damaging	0.65
R5437:Uaca	UTSW	9	60871451	missense	probably benign
R5647:Uaca	UTSW	9	60872098	missense	probably benign	0.28
R5710:Uaca	UTSW	9	60871811	missense	probably damaging	1.00
R5920:Uaca	UTSW	9	60869603	missense	probably benign	0.19
R5931:Uaca	UTSW	9	60872012	missense	probably damaging	0.97
R5933:Uaca	UTSW	9	60840956	missense	probably damaging	1.00
R5959:Uaca	UTSW	9	60870770	missense	probably damaging	1.00
R6193:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6195:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6242:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6244:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6274:Uaca	UTSW	9	60850291	splice site	probably null
R6670:Uaca	UTSW	9	60872024	missense	probably benign	0.09
R6883:Uaca	UTSW	9	60869891	missense	probably damaging	1.00
R7011:Uaca	UTSW	9	60870368	missense	probably damaging	1.00
R7111:Uaca	UTSW	9	60871838	missense	probably benign	0.06
R7146:Uaca	UTSW	9	60870413	missense	probably damaging	0.99
R7424:Uaca	UTSW	9	60870110	missense	probably damaging	1.00
R7485:Uaca	UTSW	9	60846000	missense	probably damaging	1.00
R7510:Uaca	UTSW	9	60850205	splice site	probably null
R7688:Uaca	UTSW	9	60874127	missense	probably benign	0.11
R7724:Uaca	UTSW	9	60869905	missense	probably benign	0.24
R7743:Uaca	UTSW	9	60876395	missense	probably damaging	0.99
R8556:Uaca	UTSW	9	60870641	missense	probably damaging	0.97
R8699:Uaca	UTSW	9	60871065	missense	not run
R8814:Uaca	UTSW	9	60866398	missense	not run
X0067:Uaca	UTSW	9	60859149	missense	possibly damaging	0.69
Z1177:Uaca	UTSW	9	60874123	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGATGCCCTCAAAGACGTGC -3'
(R):5'- TTCTCTGTGGGGACAGAAAGG -3'

Sequencing Primer
(F):5'- GCCCTCAAAGACGTGCAGAAG -3'
(R):5'- CAGAAAGGGCCAGCTTAGC -3'

Posted On

2018-02-28