Incidental Mutation 'R6268:Olfr251'
ID507163
Institutional Source Beutler Lab
Gene Symbol Olfr251
Ensembl Gene ENSMUSG00000096757
Gene Nameolfactory receptor 251
SynonymsMOR170-15, GA_x6K02T2MYUG-9124-8183
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6268 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38377086-38382474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38378088 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 69 (I69T)
Ref Sequence ENSEMBL: ENSMUSP00000072514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072731] [ENSMUST00000214865]
Predicted Effect probably benign
Transcript: ENSMUST00000072731
AA Change: I69T

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072514
Gene: ENSMUSG00000096757
AA Change: I69T

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 9.8e-50 PFAM
Pfam:7tm_1 47 296 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214865
AA Change: I63T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
Afg3l1 A T 8: 123,492,926 I398F probably damaging Het
Ahctf1 T C 1: 179,763,483 H1244R probably benign Het
Ank1 A T 8: 23,109,671 K797N probably damaging Het
Anxa6 G T 11: 54,987,077 probably null Het
Ap1b1 T A 11: 5,019,493 V310E probably damaging Het
C2cd2l T C 9: 44,317,666 I123V probably damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cfap54 T A 10: 93,038,909 I542F probably damaging Het
Cfap57 G T 4: 118,569,451 Y1100* probably null Het
Coq9 A G 8: 94,850,234 E158G probably benign Het
Cox15 A T 19: 43,739,926 W303R possibly damaging Het
Cpa5 A G 6: 30,615,173 Y103C probably damaging Het
Crygn A T 5: 24,756,191 V39E probably damaging Het
Csf1 G T 3: 107,747,157 S132R possibly damaging Het
Dapk1 G A 13: 60,761,766 V1398M possibly damaging Het
Degs2 C A 12: 108,692,580 V47L probably damaging Het
Dock5 C A 14: 67,790,275 E1057* probably null Het
Doxl2 T A 6: 48,977,682 Y585N probably benign Het
Dsg1b C A 18: 20,388,163 Q26K probably benign Het
Fam181a T C 12: 103,316,544 V236A possibly damaging Het
Fam78b C A 1: 167,078,553 P94T probably damaging Het
Fbxw25 T G 9: 109,654,650 T165P probably damaging Het
Flg C A 3: 93,288,175 probably benign Het
Frrs1 G T 3: 116,903,099 V573F probably damaging Het
Gm7298 A G 6: 121,779,073 T964A possibly damaging Het
Hoxd9 G T 2: 74,698,089 V12L probably damaging Het
Ikbkap T C 4: 56,762,305 Y1098C probably damaging Het
Kcnt1 A G 2: 25,903,597 probably null Het
Klhl3 G T 13: 58,013,842 R480S probably damaging Het
Klhl36 A G 8: 119,870,667 D369G probably damaging Het
Lama3 T A 18: 12,524,737 N303K probably damaging Het
Lhcgr T C 17: 88,742,704 T465A probably damaging Het
Llgl1 T C 11: 60,712,163 V888A probably benign Het
Lrp1b T A 2: 40,821,717 T3164S probably benign Het
Mmp3 T G 9: 7,447,622 D202E possibly damaging Het
Mocs1 C A 17: 49,435,155 T104K probably damaging Het
Mrpl42 A T 10: 95,496,707 probably null Het
Mtch2 T C 2: 90,863,648 C279R probably benign Het
Muc4 A T 16: 32,768,767 D2836V probably damaging Het
Myh7 T C 14: 54,989,284 E370G probably benign Het
Naa11 A G 5: 97,392,210 Y30H probably damaging Het
Ntng1 T C 3: 109,935,035 T141A probably damaging Het
Olfr1499 A T 19: 13,815,307 Y94* probably null Het
Olfr196 A C 16: 59,167,293 probably null Het
Pcdha12 G A 18: 37,022,424 C732Y possibly damaging Het
Plekhm2 G A 4: 141,632,341 Q392* probably null Het
Prr22 G A 17: 56,771,587 V247M probably damaging Het
Rapgef6 T A 11: 54,649,247 L716Q probably damaging Het
Rasgrp4 G A 7: 29,143,068 V246I probably damaging Het
Rhbdd2 C T 5: 135,643,260 T323I probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Scgb2b20 A T 7: 33,364,548 I99K possibly damaging Het
Scyl3 C T 1: 163,946,217 R324* probably null Het
Slc23a1 T C 18: 35,619,571 Y551C probably damaging Het
Slc5a5 A T 8: 70,888,620 S358R probably damaging Het
Sorcs3 T A 19: 48,790,166 N1007K probably damaging Het
Stxbp4 T A 11: 90,540,201 K428* probably null Het
Tmem63c T A 12: 87,081,953 I584N probably damaging Het
Traf3ip3 C T 1: 193,198,036 probably benign Het
Trgv2 G A 13: 19,336,831 T31I probably benign Het
Ttll3 C T 6: 113,392,563 R23C probably benign Het
Ugt2a3 A C 5: 87,329,613 L309R probably damaging Het
Urb1 A G 16: 90,753,919 M2015T probably benign Het
Vmn2r14 A C 5: 109,221,417 S97A possibly damaging Het
Vps13c C A 9: 67,951,449 T2727K probably benign Het
Xrn1 T A 9: 95,964,014 I40K probably damaging Het
Zc3h11a A G 1: 133,624,557 V604A probably benign Het
Zfp410 G A 12: 84,331,838 R259H probably benign Het
Zfp748 A G 13: 67,542,586 V185A possibly damaging Het
Other mutations in Olfr251
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02013:Olfr251 APN 9 38378077 missense probably benign 0.31
IGL02131:Olfr251 APN 9 38377907 missense probably benign 0.01
IGL02311:Olfr251 APN 9 38377898 nonsense probably null
IGL02377:Olfr251 APN 9 38378246 missense probably damaging 1.00
R0284:Olfr251 UTSW 9 38378584 missense probably benign 0.00
R0412:Olfr251 UTSW 9 38378794 missense probably damaging 0.98
R0903:Olfr251 UTSW 9 38378801 missense probably benign 0.00
R1664:Olfr251 UTSW 9 38378252 missense possibly damaging 0.93
R2902:Olfr251 UTSW 9 38378041 missense possibly damaging 0.89
R3970:Olfr251 UTSW 9 38377926 missense probably damaging 0.98
R4191:Olfr251 UTSW 9 38378352 missense probably damaging 0.98
R4650:Olfr251 UTSW 9 38378403 missense probably damaging 1.00
R4910:Olfr251 UTSW 9 38378742 missense probably null 0.98
R5256:Olfr251 UTSW 9 38377917 missense probably benign 0.00
R5385:Olfr251 UTSW 9 38377985 missense probably benign
R5386:Olfr251 UTSW 9 38377985 missense probably benign
R6005:Olfr251 UTSW 9 38378309 missense probably damaging 1.00
R6486:Olfr251 UTSW 9 38377904 missense probably benign
R7019:Olfr251 UTSW 9 38378802 missense possibly damaging 0.89
R7045:Olfr251 UTSW 9 38378433 missense probably damaging 0.99
R7120:Olfr251 UTSW 9 38378649 missense probably damaging 1.00
R7329:Olfr251 UTSW 9 38378160 missense probably benign 0.00
R7703:Olfr251 UTSW 9 38378061 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTCTGGGATGAATGATGTTAGTG -3'
(R):5'- ATCATAGGCCATGGCTGTCAG -3'

Sequencing Primer
(F):5'- TGAAAGTCATGAAGCAAATGGTTAC -3'
(R):5'- GCTGTCAGCACATAACATTCAGAG -3'
Posted On2018-03-15