Incidental Mutation 'R3970:Olfr251'
ID310924
Institutional Source Beutler Lab
Gene Symbol Olfr251
Ensembl Gene ENSMUSG00000096757
Gene Nameolfactory receptor 251
SynonymsMOR170-15, GA_x6K02T2MYUG-9124-8183
MMRRC Submission 040938-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3970 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38377086-38382474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38377926 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 15 (V15A)
Ref Sequence ENSEMBL: ENSMUSP00000072514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072731] [ENSMUST00000214865]
Predicted Effect probably damaging
Transcript: ENSMUST00000072731
AA Change: V15A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072514
Gene: ENSMUSG00000096757
AA Change: V15A

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 9.8e-50 PFAM
Pfam:7tm_1 47 296 4.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214865
AA Change: V9A

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.5031 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,322 M583T probably damaging Het
Actn4 T C 7: 28,962,032 K51R probably benign Het
Adamts15 T C 9: 30,910,602 Y513C probably benign Het
Akap13 T A 7: 75,569,951 L34* probably null Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Ano1 T C 7: 144,607,963 N749D probably benign Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cherp T C 8: 72,469,951 H196R possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Col11a1 A T 3: 114,097,189 T392S unknown Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Csf2rb T C 15: 78,341,467 V286A probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Kif5c A G 2: 49,688,744 E128G probably damaging Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Myrf A G 19: 10,223,237 L332P probably damaging Het
Nampt T A 12: 32,833,096 D93E probably benign Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrp6 C A 7: 140,921,655 A45E probably damaging Het
Obscn G A 11: 59,051,662 P4898L probably damaging Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pcdh8 C T 14: 79,770,266 G286S possibly damaging Het
Pcdha2 C A 18: 36,940,697 Y460* probably null Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pign A C 1: 105,656,003 S125A probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkd1l1 C T 11: 8,874,218 E1566K probably damaging Het
Plcb2 A G 2: 118,715,690 probably benign Het
Ppl T C 16: 5,100,332 probably null Het
Pramel4 A T 4: 144,068,474 N477I possibly damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Sema3g T C 14: 31,226,521 probably null Het
Sf3b1 G A 1: 55,012,182 R196* probably null Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc6a7 A C 18: 61,003,345 L328R possibly damaging Het
Stab2 T C 10: 86,878,886 T139A probably damaging Het
Tiam2 T A 17: 3,428,831 I613N probably damaging Het
Tlk1 A G 2: 70,716,652 V695A probably damaging Het
Trpc2 A G 7: 102,084,324 D160G probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Vwa7 G A 17: 35,017,708 A84T probably damaging Het
Zfp219 T A 14: 52,006,964 Q541L probably benign Het
Other mutations in Olfr251
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02013:Olfr251 APN 9 38378077 missense probably benign 0.31
IGL02131:Olfr251 APN 9 38377907 missense probably benign 0.01
IGL02311:Olfr251 APN 9 38377898 nonsense probably null
IGL02377:Olfr251 APN 9 38378246 missense probably damaging 1.00
R0284:Olfr251 UTSW 9 38378584 missense probably benign 0.00
R0412:Olfr251 UTSW 9 38378794 missense probably damaging 0.98
R0903:Olfr251 UTSW 9 38378801 missense probably benign 0.00
R1664:Olfr251 UTSW 9 38378252 missense possibly damaging 0.93
R2902:Olfr251 UTSW 9 38378041 missense possibly damaging 0.89
R4191:Olfr251 UTSW 9 38378352 missense probably damaging 0.98
R4650:Olfr251 UTSW 9 38378403 missense probably damaging 1.00
R4910:Olfr251 UTSW 9 38378742 missense probably null 0.98
R5256:Olfr251 UTSW 9 38377917 missense probably benign 0.00
R5385:Olfr251 UTSW 9 38377985 missense probably benign
R5386:Olfr251 UTSW 9 38377985 missense probably benign
R6005:Olfr251 UTSW 9 38378309 missense probably damaging 1.00
R6268:Olfr251 UTSW 9 38378088 missense probably benign 0.10
R6486:Olfr251 UTSW 9 38377904 missense probably benign
R7019:Olfr251 UTSW 9 38378802 missense possibly damaging 0.89
R7045:Olfr251 UTSW 9 38378433 missense probably damaging 0.99
R7120:Olfr251 UTSW 9 38378649 missense probably damaging 1.00
R7329:Olfr251 UTSW 9 38378160 missense probably benign 0.00
R7703:Olfr251 UTSW 9 38378061 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACATTAGAGAGATCTGTCTTCAC -3'
(R):5'- CTCCTCAGCATTGTGGGGTTAG -3'

Sequencing Primer
(F):5'- CAGGAAATGGGACTTTTTGAGG -3'
(R):5'- CAGCATTGTGGGGTTAGAAACAAATG -3'
Posted On2015-04-29