Incidental Mutation 'R6268:Olfr1499'
ID507194
Institutional Source Beutler Lab
Gene Symbol Olfr1499
Ensembl Gene ENSMUSG00000045395
Gene Nameolfactory receptor 1499
SynonymsMOR211-2, GA_x6K02T2RE5P-4147744-4146800
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6268 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13814275-13819447 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 13815307 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 94 (Y94*)
Ref Sequence ENSEMBL: ENSMUSP00000150330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055672] [ENSMUST00000216659]
Predicted Effect probably null
Transcript: ENSMUST00000055672
AA Change: Y94*
SMART Domains Protein: ENSMUSP00000059747
Gene: ENSMUSG00000045395
AA Change: Y94*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.6e-44 PFAM
Pfam:7tm_1 41 290 1.5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216659
AA Change: Y94*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
Afg3l1 A T 8: 123,492,926 I398F probably damaging Het
Ahctf1 T C 1: 179,763,483 H1244R probably benign Het
Ank1 A T 8: 23,109,671 K797N probably damaging Het
Anxa6 G T 11: 54,987,077 probably null Het
Ap1b1 T A 11: 5,019,493 V310E probably damaging Het
C2cd2l T C 9: 44,317,666 I123V probably damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cfap54 T A 10: 93,038,909 I542F probably damaging Het
Cfap57 G T 4: 118,569,451 Y1100* probably null Het
Coq9 A G 8: 94,850,234 E158G probably benign Het
Cox15 A T 19: 43,739,926 W303R possibly damaging Het
Cpa5 A G 6: 30,615,173 Y103C probably damaging Het
Crygn A T 5: 24,756,191 V39E probably damaging Het
Csf1 G T 3: 107,747,157 S132R possibly damaging Het
Dapk1 G A 13: 60,761,766 V1398M possibly damaging Het
Degs2 C A 12: 108,692,580 V47L probably damaging Het
Dock5 C A 14: 67,790,275 E1057* probably null Het
Doxl2 T A 6: 48,977,682 Y585N probably benign Het
Dsg1b C A 18: 20,388,163 Q26K probably benign Het
Fam181a T C 12: 103,316,544 V236A possibly damaging Het
Fam78b C A 1: 167,078,553 P94T probably damaging Het
Fbxw25 T G 9: 109,654,650 T165P probably damaging Het
Flg C A 3: 93,288,175 probably benign Het
Frrs1 G T 3: 116,903,099 V573F probably damaging Het
Gm7298 A G 6: 121,779,073 T964A possibly damaging Het
Hoxd9 G T 2: 74,698,089 V12L probably damaging Het
Ikbkap T C 4: 56,762,305 Y1098C probably damaging Het
Kcnt1 A G 2: 25,903,597 probably null Het
Klhl3 G T 13: 58,013,842 R480S probably damaging Het
Klhl36 A G 8: 119,870,667 D369G probably damaging Het
Lama3 T A 18: 12,524,737 N303K probably damaging Het
Lhcgr T C 17: 88,742,704 T465A probably damaging Het
Llgl1 T C 11: 60,712,163 V888A probably benign Het
Lrp1b T A 2: 40,821,717 T3164S probably benign Het
Mmp3 T G 9: 7,447,622 D202E possibly damaging Het
Mocs1 C A 17: 49,435,155 T104K probably damaging Het
Mrpl42 A T 10: 95,496,707 probably null Het
Mtch2 T C 2: 90,863,648 C279R probably benign Het
Muc4 A T 16: 32,768,767 D2836V probably damaging Het
Myh7 T C 14: 54,989,284 E370G probably benign Het
Naa11 A G 5: 97,392,210 Y30H probably damaging Het
Ntng1 T C 3: 109,935,035 T141A probably damaging Het
Olfr196 A C 16: 59,167,293 probably null Het
Olfr251 T C 9: 38,378,088 I69T probably benign Het
Pcdha12 G A 18: 37,022,424 C732Y possibly damaging Het
Plekhm2 G A 4: 141,632,341 Q392* probably null Het
Prr22 G A 17: 56,771,587 V247M probably damaging Het
Rapgef6 T A 11: 54,649,247 L716Q probably damaging Het
Rasgrp4 G A 7: 29,143,068 V246I probably damaging Het
Rhbdd2 C T 5: 135,643,260 T323I probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Scgb2b20 A T 7: 33,364,548 I99K possibly damaging Het
Scyl3 C T 1: 163,946,217 R324* probably null Het
Slc23a1 T C 18: 35,619,571 Y551C probably damaging Het
Slc5a5 A T 8: 70,888,620 S358R probably damaging Het
Sorcs3 T A 19: 48,790,166 N1007K probably damaging Het
Stxbp4 T A 11: 90,540,201 K428* probably null Het
Tmem63c T A 12: 87,081,953 I584N probably damaging Het
Traf3ip3 C T 1: 193,198,036 probably benign Het
Trgv2 G A 13: 19,336,831 T31I probably benign Het
Ttll3 C T 6: 113,392,563 R23C probably benign Het
Ugt2a3 A C 5: 87,329,613 L309R probably damaging Het
Urb1 A G 16: 90,753,919 M2015T probably benign Het
Vmn2r14 A C 5: 109,221,417 S97A possibly damaging Het
Vps13c C A 9: 67,951,449 T2727K probably benign Het
Xrn1 T A 9: 95,964,014 I40K probably damaging Het
Zc3h11a A G 1: 133,624,557 V604A probably benign Het
Zfp410 G A 12: 84,331,838 R259H probably benign Het
Zfp748 A G 13: 67,542,586 V185A possibly damaging Het
Other mutations in Olfr1499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1499 APN 19 13815302 missense probably benign 0.09
IGL01844:Olfr1499 APN 19 13814816 missense possibly damaging 0.95
IGL03102:Olfr1499 APN 19 13815371 missense probably damaging 1.00
IGL03352:Olfr1499 APN 19 13814928 missense probably damaging 1.00
R0218:Olfr1499 UTSW 19 13814978 missense probably benign 0.19
R0490:Olfr1499 UTSW 19 13814855 missense probably damaging 1.00
R0682:Olfr1499 UTSW 19 13815137 missense possibly damaging 0.94
R1301:Olfr1499 UTSW 19 13815362 missense probably damaging 1.00
R1328:Olfr1499 UTSW 19 13815536 missense probably benign 0.01
R2100:Olfr1499 UTSW 19 13815236 missense possibly damaging 0.95
R3701:Olfr1499 UTSW 19 13815348 missense probably benign 0.03
R4563:Olfr1499 UTSW 19 13815282 missense probably benign 0.01
R4709:Olfr1499 UTSW 19 13815450 missense possibly damaging 0.94
R5231:Olfr1499 UTSW 19 13815347 missense probably damaging 0.99
R5301:Olfr1499 UTSW 19 13815569 missense probably damaging 0.99
R5343:Olfr1499 UTSW 19 13814960 missense probably damaging 1.00
R6442:Olfr1499 UTSW 19 13815628 start gained probably benign
R7132:Olfr1499 UTSW 19 13815422 missense probably benign 0.09
R7764:Olfr1499 UTSW 19 13814747 missense probably benign 0.01
Z1088:Olfr1499 UTSW 19 13815548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAATGGACCCAGATAACCC -3'
(R):5'- TACTGACCATCCAGAGTGGG -3'

Sequencing Primer
(F):5'- TGGACCCAGATAACCCACATACATAG -3'
(R):5'- ATCCAGAGTGGGAGGTTCCTC -3'
Posted On2018-03-15