Incidental Mutation 'R6287:Olfr810'
ID508273
Institutional Source Beutler Lab
Gene Symbol Olfr810
Ensembl Gene ENSMUSG00000069421
Gene Nameolfactory receptor 810
SynonymsMOR113-4, GA_x6K02T2PULF-11470271-11469333
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6287 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129787289-129794917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129791385 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 68 (E68G)
Ref Sequence ENSEMBL: ENSMUSP00000150364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091986] [ENSMUST00000214206] [ENSMUST00000214878] [ENSMUST00000217283]
Predicted Effect probably damaging
Transcript: ENSMUST00000091986
AA Change: E68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089612
Gene: ENSMUSG00000069421
AA Change: E68G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 7.3e-50 PFAM
Pfam:7tm_1 39 288 5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214206
AA Change: E68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214878
AA Change: E68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217283
AA Change: E68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,311,108 N268S possibly damaging Het
Ahnak T A 19: 9,015,003 H4550Q probably benign Het
C330018D20Rik A C 18: 56,962,335 probably null Het
Camta2 G C 11: 70,681,469 Q310E probably damaging Het
Caskin1 A T 17: 24,496,709 K149M probably damaging Het
Chml T C 1: 175,687,003 K108E probably benign Het
Ddx60 T C 8: 61,950,578 L345P probably damaging Het
Defb6 T A 8: 19,228,069 C52* probably null Het
Flii A T 11: 60,721,597 I288N probably damaging Het
Fmnl2 T C 2: 53,014,848 Y55H probably damaging Het
Galk2 A T 2: 125,870,348 probably benign Het
Ift140 T A 17: 25,050,434 C688S probably benign Het
Lmln T C 16: 33,074,185 probably null Het
Muc16 T C 9: 18,659,034 T730A unknown Het
Nup88 T C 11: 70,965,755 E184G probably benign Het
Olfr1234 G A 2: 89,363,019 R137* probably null Het
Olfr13 A G 6: 43,174,435 I150V probably benign Het
Olfr1383 A G 11: 49,524,245 N174S probably damaging Het
Olfr1512 A T 14: 52,372,291 V254E probably damaging Het
Omt2b T C 9: 78,328,261 F27L possibly damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pigf G A 17: 86,997,539 A192V probably damaging Het
Pikfyve T C 1: 65,253,532 probably null Het
Ppat A T 5: 76,918,214 Y352* probably null Het
Rapgef6 T G 11: 54,626,338 probably null Het
Rrp15 A T 1: 186,749,176 S45T probably benign Het
Sap18 A G 14: 57,798,314 E30G probably damaging Het
Snx6 G T 12: 54,747,028 A284E possibly damaging Het
Tm4sf4 T A 3: 57,425,691 I26N probably damaging Het
Traf5 A G 1: 191,999,872 L336P probably damaging Het
Ttl G A 2: 129,089,121 A335T probably damaging Het
Vmn2r87 C T 10: 130,478,422 probably null Het
Zfp74 G A 7: 29,935,776 T169I probably benign Het
Zfp937 A T 2: 150,238,341 H97L possibly damaging Het
Zzef1 G T 11: 72,923,112 E2842D probably damaging Het
Other mutations in Olfr810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr810 APN 10 129791319 missense probably damaging 0.98
IGL02365:Olfr810 APN 10 129791535 missense possibly damaging 0.81
IGL02508:Olfr810 APN 10 129790791 missense probably benign 0.44
R0638:Olfr810 UTSW 10 129791232 missense probably damaging 1.00
R0680:Olfr810 UTSW 10 129790818 missense probably damaging 1.00
R0847:Olfr810 UTSW 10 129791458 missense probably damaging 1.00
R1449:Olfr810 UTSW 10 129790854 missense probably damaging 1.00
R1776:Olfr810 UTSW 10 129791131 missense probably benign 0.00
R1938:Olfr810 UTSW 10 129790890 missense probably damaging 1.00
R3836:Olfr810 UTSW 10 129791170 missense probably benign 0.01
R4521:Olfr810 UTSW 10 129791181 missense possibly damaging 0.58
R4816:Olfr810 UTSW 10 129791439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTGCAGATGGCTACATATC -3'
(R):5'- GCGAACAGTCAGAGGTTCAC -3'

Sequencing Primer
(F):5'- GCAGATGGCTACATATCTGTCATAGG -3'
(R):5'- GAGTGACAGTTTTCATCATAGCAGG -3'
Posted On2018-03-15