Incidental Mutation 'R6316:Trib1'
ID510000
Institutional Source Beutler Lab
Gene Symbol Trib1
Ensembl Gene ENSMUSG00000032501
Gene Nametribbles pseudokinase 1
SynonymsTrb1, A530090O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6316 (G1)
Quality Score195.009
Status Validated
Chromosome15
Chromosomal Location59648350-59657099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59649415 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 85 (S85P)
Ref Sequence ENSEMBL: ENSMUSP00000112828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067543] [ENSMUST00000118228]
Predicted Effect probably benign
Transcript: ENSMUST00000067543
AA Change: S85P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068834
Gene: ENSMUSG00000032501
AA Change: S85P

DomainStartEndE-ValueType
low complexity region 61 82 N/A INTRINSIC
Pfam:Pkinase 105 338 1.1e-33 PFAM
Pfam:Pkinase_Tyr 120 335 2.1e-15 PFAM
Pfam:Kinase-like 124 326 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118228
AA Change: S85P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112828
Gene: ENSMUSG00000032501
AA Change: S85P

DomainStartEndE-ValueType
low complexity region 61 82 N/A INTRINSIC
Pfam:Pkinase 104 218 7.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Macrophages from mice homozygous for a knock-out allele exhibit impaired IL12 response to LPS, MALP-1, or CpG DNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,313,959 T775A probably benign Het
Adam6a A T 12: 113,545,576 N523I probably benign Het
Adgrv1 T C 13: 81,499,068 T3118A possibly damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Asxl3 A G 18: 22,522,782 Y1283C probably damaging Het
BC005561 G C 5: 104,519,729 G706R probably damaging Het
Btbd2 T A 10: 80,644,778 I319F probably damaging Het
Eno4 G A 19: 58,960,291 probably null Het
Glis2 T A 16: 4,613,836 probably benign Het
Grin2b A T 6: 135,780,279 C395S probably benign Het
H1foo T C 6: 115,948,915 probably null Het
Kansl1l T A 1: 66,735,585 Y694F probably benign Het
Kcnj1 A T 9: 32,397,336 E332V probably damaging Het
Klhdc7a T C 4: 139,966,802 E278G probably benign Het
Krt33a T C 11: 100,014,201 N160D probably damaging Het
Ksr2 A G 5: 117,685,502 N448S probably damaging Het
Lpar6 A G 14: 73,239,334 Y245C probably damaging Het
Magel2 T C 7: 62,378,719 I457T possibly damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Moxd2 T C 6: 40,883,547 D321G probably damaging Het
Mtmr12 T A 15: 12,236,113 C153S probably null Het
Muc16 T C 9: 18,641,819 T4393A probably benign Het
Notch3 T C 17: 32,137,813 probably null Het
Olfr311 A G 11: 58,841,942 Y276C probably damaging Het
Pirb T A 7: 3,717,823 K225N probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Rilpl2 A G 5: 124,477,880 V69A probably damaging Het
Smdt1 T C 15: 82,348,009 V99A probably damaging Het
Smpd1 T C 7: 105,555,502 V196A probably benign Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tcte1 A G 17: 45,534,860 H130R probably benign Het
Tead1 C A 7: 112,891,839 Q296K probably damaging Het
Tmem163 C T 1: 127,551,365 S139N probably benign Het
Tor1aip2 G T 1: 156,062,094 D192Y probably damaging Het
Trgv2 G A 13: 19,336,742 Q61* probably null Het
Trrap T A 5: 144,813,526 N1581K probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Xrn2 A G 2: 147,042,010 Y563C probably damaging Het
Other mutations in Trib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Trib1 APN 15 59651627 missense probably damaging 1.00
IGL01648:Trib1 APN 15 59654501 missense probably benign 0.38
IGL02267:Trib1 APN 15 59651600 missense probably damaging 0.98
IGL03018:Trib1 APN 15 59654484 missense probably damaging 1.00
topcat UTSW 15 59651638 nonsense probably null
R1994:Trib1 UTSW 15 59649343 missense possibly damaging 0.70
R2073:Trib1 UTSW 15 59654340 missense probably damaging 1.00
R2407:Trib1 UTSW 15 59654600 missense probably benign 0.00
R3709:Trib1 UTSW 15 59654361 missense probably damaging 1.00
R5759:Trib1 UTSW 15 59654501 missense probably benign
R5986:Trib1 UTSW 15 59654602 unclassified probably null
R6083:Trib1 UTSW 15 59654475 missense probably damaging 1.00
R6084:Trib1 UTSW 15 59654475 missense probably damaging 1.00
R6086:Trib1 UTSW 15 59654475 missense probably damaging 1.00
R6112:Trib1 UTSW 15 59651638 nonsense probably null
R6113:Trib1 UTSW 15 59651638 nonsense probably null
R7288:Trib1 UTSW 15 59654622 missense probably benign
R7663:Trib1 UTSW 15 59651713 missense probably damaging 1.00
R7744:Trib1 UTSW 15 59654663 missense probably benign 0.04
R8061:Trib1 UTSW 15 59651555 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATCCAGGGATTTACAAAGCCGG -3'
(R):5'- GGAACCTAGGCACTTCTGTG -3'

Sequencing Primer
(F):5'- ATTTACAAAGCCGGGGCCG -3'
(R):5'- CTAGGCACTTCTGTGGACGATC -3'
Posted On2018-04-02