Incidental Mutation 'FR4449:Cacna1a'
ID 511488
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Name calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms Cacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock # FR4449 ()
Quality Score 217.468
Status Not validated
Chromosome 8
Chromosomal Location 84388440-84640246 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) ACC to ACCGCC at 84638723 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
AlphaFold P97445
Predicted Effect probably benign
Transcript: ENSMUST00000121390
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122053
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144879
Predicted Effect probably benign
Transcript: ENSMUST00000215756
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
4932415D10Rik TTCAGT TT 10: 82,285,469 probably null Homo
Akap9 GGTATTGCATTTCTTATCT G 5: 3,981,214 probably benign Homo
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCGATAAAGC 18: 34,282,000 probably benign Het
Apc AGC AGCCAATAACGC 18: 34,282,005 probably benign Het
Apol6 TTT TTTGATT 15: 77,051,443 probably null Homo
Arid1b CGG CGGTGG 17: 4,995,589 probably benign Het
B430218F22Rik CGGCG CGGCGATGGCG 13: 118,386,851 probably benign Homo
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,908 probably benign Het
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,116,336 probably benign Het
Btnl10 AAG AAGGAG 11: 58,923,928 probably benign Homo
Calhm1 TGGC TGGCTGTGGCTGCGGC 19: 47,141,274 probably benign Het
Ccdc15 C CTTTAT 9: 37,315,158 probably null Het
Ccdc85c CCG CCGACG 12: 108,274,616 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdhr2 AGTC AGTCGTC 13: 54,725,924 probably benign Homo
Cdk15 A ATCTAAAAGG 1: 59,257,823 probably benign Homo
Cdx1 GCTG GCTGCTCCTG 18: 61,019,881 probably benign Het
Cfap46 T C 7: 139,638,795 probably benign Homo
Cgref1 CTT CTTATT 5: 30,933,778 probably null Homo
Cgref1 TTC TTCGTC 5: 30,933,776 probably benign Het
Cluh G GACTGAA 11: 74,669,532 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cpne1 CCTACT CCT 2: 156,073,502 probably benign Homo
Cttnbp2 CTGCTG CTGCTGTTGCTG 6: 18,367,462 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,856 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,674 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Dhx8 AGACCG AGACCGTGACCG 11: 101,738,184 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,194 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,206 probably benign Het
Dhx8 G GAGACCC 11: 101,738,207 probably benign Het
Dspp CGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG CGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG 5: 104,178,388 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Erich3 GA GAGAA 3: 154,763,513 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,074 probably benign Het
Fgd6 GGAT G 10: 94,044,320 probably benign Homo
G530012D18Rik GAGAGAGAGAGAGAGAGACAGAGA GAGAGA 1: 85,577,180 probably benign Homo
Gar1 GCCGCCTCCGCC GCCGCC 3: 129,830,704 probably benign Homo
Gatad2b AGAC A 3: 90,341,917 probably benign Het
Gigyf2 C T 1: 87,428,585 probably benign Het
Gm16519 A AGAT 17: 70,929,338 probably benign Homo
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,085 probably benign Het
Gm4340 GCA GCATCA 10: 104,196,086 probably benign Het
Gpatch11 AGGAAG AGGAAGCGGAAG 17: 78,842,168 probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,176 probably benign Het
Gpatch11 GG GGCAGACG 17: 78,842,181 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igkv12-89 GCA GCAGCAGCAACA 6: 68,835,280 probably benign Homo
Igsf10 G A 3: 59,319,110 R2381C probably damaging Homo
Il17rd GGC GGCAGC 14: 27,082,678 probably benign Het
Ints5 G A 19: 8,897,230 R851Q probably benign Het
Isg20l2 AGA AGAGGA 3: 87,931,713 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kifc5b A C 17: 26,924,217 E321A probably benign Het
Klra2 TCCACAG TCCACAGAAACCCACAG 6: 131,221,846 probably null Homo
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Krt10 ACC ACCACCTCC 11: 99,389,267 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Lce1m AC ACTGCTGCTGCCGC 3: 93,018,152 probably benign Het
Leo1 GTACCATGCA G 9: 75,450,573 probably benign Het
Lkaaear1 CA CATCTCCAGCTCTA 2: 181,697,571 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Homo
Med12l CAG CAGTAG 3: 59,275,963 probably null Het
Mgat4e GTCGTAGTCATCGT GTCGT 1: 134,540,997 probably benign Homo
Mn1 GCA GCAACA 5: 111,419,710 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG 19: 42,076,109 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Noc2l C CTGA 4: 156,240,101 probably benign Het
Nrg3 T TAGACAC 14: 38,397,271 probably benign Het
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pih1d2 CTCTTGCGAGGATC CTC 9: 50,621,627 probably null Homo
Pik3ap1 G GGAA 19: 41,281,946 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Qrich2 AACT A 11: 116,456,199 probably benign Homo
Raet1d A ATATCCTCTCTGG 10: 22,370,915 probably benign Het
Rbm33 AGCAGCAGCAGCACCAGCCGCAGCAGCAGCA AGCAGCAGCAGCA 5: 28,394,168 probably benign Homo
Rrbp1 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC 2: 143,967,456 probably null Het
Sbp CAACAAAGATGCTGA CAACAAAGATGCTGAGAACAAAGATGCTGA 17: 23,945,364 probably benign Het
Setd1a G A 7: 127,785,326 probably benign Het
Sfswap CCCACTCAG CCCACTCAGTCCACTCAG 5: 129,569,748 probably benign Het
Sfswap CCACTCAGC CCACTCAGCTCACTCAGC 5: 129,569,749 probably benign Het
Sh3pxd2b T TGTCTGC 11: 32,423,065 probably benign Homo
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Slc12a1 C CTTTGGCCACAACACG 2: 125,154,216 probably benign Homo
Slc26a8 CTCTCTG C 17: 28,638,316 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Sry TGCTG TGCTGCTG Y: 2,662,832 probably benign Homo
Ston1 G A 17: 88,635,525 V120M probably benign Homo
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,649 probably benign Het
Tbl3 TG TGTGG 17: 24,702,544 probably benign Homo
Tctn3 AG AGAAGCCG 19: 40,607,202 probably benign Het
Tesk1 CCC CCCACC 4: 43,447,002 probably benign Homo
Tmc2 T G 2: 130,240,196 V433G probably damaging Het
Tmprss13 G A 9: 45,328,558 A55T unknown Het
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,839 probably null Homo
Tob1 CAG CAGAAG 11: 94,214,468 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,475 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Homo
Triobp GTC GTCTTC 15: 78,993,389 probably benign Het
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Xpnpep3 G C 15: 81,427,422 D110H possibly damaging Het
Zc3h13 CGAGATGTG CGAGATGTGTGAGATGTG 14: 75,323,601 probably null Homo
Zfhx3 GCAACAGCA GCAACAGCAACAACAGCA 8: 108,956,094 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 CTC CTCATC 2: 164,907,477 probably benign Het
Zfp335 CTCT CTCTTCT 2: 164,907,483 probably benign Het
Zfp598 ACCACC ACCACCTCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,785 probably benign Het
Zfp831 TCC TCCACC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCGTC 2: 174,645,482 probably benign Het
Zfp978 G T 4: 147,390,944 S316I probably benign Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
R7270:Cacna1a UTSW 8 84571237 missense probably damaging 1.00
R7409:Cacna1a UTSW 8 84533402 missense probably damaging 1.00
R7491:Cacna1a UTSW 8 84559293 missense possibly damaging 0.92
R7511:Cacna1a UTSW 8 84567682 missense possibly damaging 0.75
R7745:Cacna1a UTSW 8 84559394 missense probably benign 0.01
R7872:Cacna1a UTSW 8 84583654 missense probably damaging 1.00
R7899:Cacna1a UTSW 8 84594173 missense possibly damaging 0.72
R7986:Cacna1a UTSW 8 84638779 missense probably benign 0.02
R8126:Cacna1a UTSW 8 84633252 missense probably benign 0.02
R8266:Cacna1a UTSW 8 84559219 missense probably damaging 1.00
R8458:Cacna1a UTSW 8 84549458 missense probably damaging 1.00
R8504:Cacna1a UTSW 8 84638741 missense probably benign
R8530:Cacna1a UTSW 8 84612414 critical splice donor site probably null
R8750:Cacna1a UTSW 8 84559155 missense probably damaging 0.99
R8817:Cacna1a UTSW 8 84638797 missense probably benign 0.44
R8856:Cacna1a UTSW 8 84559441 missense probably benign 0.30
R8893:Cacna1a UTSW 8 84587135 missense probably benign 0.00
R9083:Cacna1a UTSW 8 84617882 missense probably benign 0.30
R9087:Cacna1a UTSW 8 84638803 missense probably benign 0.44
R9118:Cacna1a UTSW 8 84536086 missense probably damaging 1.00
R9133:Cacna1a UTSW 8 84549523 missense probably damaging 1.00
R9175:Cacna1a UTSW 8 84570015 missense probably damaging 0.99
R9233:Cacna1a UTSW 8 84544654 missense probably damaging 1.00
R9310:Cacna1a UTSW 8 84536417 missense probably damaging 1.00
R9331:Cacna1a UTSW 8 84415817 missense probably damaging 1.00
R9334:Cacna1a UTSW 8 84569965 missense probably damaging 1.00
R9531:Cacna1a UTSW 8 84594172 missense probably benign 0.02
R9532:Cacna1a UTSW 8 84611617 missense probably damaging 1.00
R9590:Cacna1a UTSW 8 84601981 nonsense probably null
RF029:Cacna1a UTSW 8 84638724 small insertion probably benign
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Z1176:Cacna1a UTSW 8 84415676 missense unknown
Z1177:Cacna1a UTSW 8 84579491 missense probably damaging 1.00
Z1188:Cacna1a UTSW 8 84515054 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGATGATGCCACGAGGG -3'
(R):5'- TTCCGAAGTCACTCACAGGC -3'

Sequencing Primer
(F):5'- GAAACCAGGGGCTGCTG -3'
(R):5'- AAGTCACTCACAGGCGTCCG -3'
Posted On 2018-04-05