Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Cacna1a'

169454

Institutional Source

Beutler Lab

Gene Symbol

Cacna1a

Ensembl Gene

ENSMUSG00000034656

Gene Name

calcium channel, voltage-dependent, P/Q type, alpha 1A subunit

Synonyms

Cacnl1a4, alpha1A, SCA6, nmf352, Ccha1a

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84388440-84640246 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84601946 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1624 (D1624G)

Ref Sequence

ENSEMBL: ENSMUSP00000114055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]

AlphaFold

P97445

Predicted Effect

probably benign
Transcript: ENSMUST00000121390
AA Change: D1671G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: D1671G

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	99	373	1.5e-69	PFAM
Pfam:Ion_trans	488	727	1.2e-54	PFAM
Pfam:PKD_channel	578	721	6.6e-8	PFAM
low complexity region	920	959	N/A	INTRINSIC
low complexity region	977	987	N/A	INTRINSIC
low complexity region	1074	1093	N/A	INTRINSIC
low complexity region	1143	1168	N/A	INTRINSIC
Pfam:Ion_trans	1194	1472	4.9e-64	PFAM
Pfam:Ion_trans	1516	1773	2.8e-64	PFAM
Pfam:GPHH	1775	1844	5.6e-39	PFAM
Ca_chan_IQ	1899	1933	1.8e-12	SMART
AT_hook	2053	2065	2.02e0	SMART
low complexity region	2101	2113	N/A	INTRINSIC
low complexity region	2153	2179	N/A	INTRINSIC
low complexity region	2213	2236	N/A	INTRINSIC
low complexity region	2253	2282	N/A	INTRINSIC
low complexity region	2314	2325	N/A	INTRINSIC
low complexity region	2342	2357	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122053
AA Change: D1624G

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: D1624G

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	91	314	4.5e-58	PFAM
PDB:4DEX\|B	317	427	5e-45	PDB
Pfam:Ion_trans	476	668	6.4e-46	PFAM
Pfam:PKD_channel	530	675	7.7e-8	PFAM
low complexity region	873	912	N/A	INTRINSIC
low complexity region	930	940	N/A	INTRINSIC
low complexity region	1027	1046	N/A	INTRINSIC
low complexity region	1096	1121	N/A	INTRINSIC
Pfam:Ion_trans	1183	1414	2.8e-54	PFAM
Pfam:Ion_trans	1504	1714	3.2e-60	PFAM
Ca_chan_IQ	1852	1886	1.8e-12	SMART
AT_hook	2006	2018	2.02e0	SMART
low complexity region	2054	2066	N/A	INTRINSIC
low complexity region	2106	2132	N/A	INTRINSIC
low complexity region	2166	2189	N/A	INTRINSIC
low complexity region	2206	2235	N/A	INTRINSIC
low complexity region	2267	2278	N/A	INTRINSIC
low complexity region	2295	2310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141981

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143215

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144879

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153691

Predicted Effect

unknown
Transcript: ENSMUST00000215756
AA Change: D1623G

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Cacna1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Cacna1a	APN	8	84571208	nonsense	probably null
IGL00513:Cacna1a	APN	8	84553056	missense	probably damaging	1.00
IGL00569:Cacna1a	APN	8	84462714	missense	probably damaging	1.00
IGL00981:Cacna1a	APN	8	84548553	missense	probably damaging	1.00
IGL01122:Cacna1a	APN	8	84614793	critical splice donor site	probably null
IGL01309:Cacna1a	APN	8	84523028	missense	probably damaging	1.00
IGL01380:Cacna1a	APN	8	84559117	missense	probably damaging	1.00
IGL01638:Cacna1a	APN	8	84571827	missense	probably damaging	0.98
IGL01682:Cacna1a	APN	8	84536438	missense	possibly damaging	0.71
IGL02751:Cacna1a	APN	8	84569952	missense	probably damaging	1.00
IGL02904:Cacna1a	APN	8	84579520	missense	probably damaging	1.00
IGL03122:Cacna1a	APN	8	84462676	splice site	probably benign
totter	UTSW	8	84588753	missense	probably damaging	0.99
totter2	UTSW	8	84588753	missense	probably damaging	0.99
FR4340:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638714	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4548:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638726	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638726	small insertion	probably benign
IGL03134:Cacna1a	UTSW	8	84559087	missense	probably damaging	1.00
R0055:Cacna1a	UTSW	8	84580058	splice site	probably benign
R0118:Cacna1a	UTSW	8	84536083	missense	probably damaging	1.00
R0284:Cacna1a	UTSW	8	84612285	missense	probably damaging	1.00
R0581:Cacna1a	UTSW	8	84601936	missense	possibly damaging	0.83
R0607:Cacna1a	UTSW	8	84629831	missense	probably damaging	1.00
R1168:Cacna1a	UTSW	8	84579501	missense	probably damaging	1.00
R1183:Cacna1a	UTSW	8	84580217	missense	probably damaging	1.00
R1470:Cacna1a	UTSW	8	84514950	splice site	probably benign
R1522:Cacna1a	UTSW	8	84633433	missense	probably benign	0.00
R1835:Cacna1a	UTSW	8	84581357	splice site	probably null
R1862:Cacna1a	UTSW	8	84415930	missense	possibly damaging	0.80
R2148:Cacna1a	UTSW	8	84629675	missense	possibly damaging	0.71
R2237:Cacna1a	UTSW	8	84633765	critical splice donor site	probably null
R2567:Cacna1a	UTSW	8	84549725	missense	probably damaging	1.00
R2999:Cacna1a	UTSW	8	84567742	missense	probably damaging	1.00
R3025:Cacna1a	UTSW	8	84580225	critical splice donor site	probably null
R3610:Cacna1a	UTSW	8	84559065	missense	probably damaging	1.00
R3702:Cacna1a	UTSW	8	84617846	missense	probably damaging	0.98
R3763:Cacna1a	UTSW	8	84583642	missense	possibly damaging	0.85
R4025:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4026:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4106:Cacna1a	UTSW	8	84583695	missense	possibly damaging	0.85
R4296:Cacna1a	UTSW	8	84559293	missense	probably damaging	1.00
R4664:Cacna1a	UTSW	8	84601767	nonsense	probably null
R4713:Cacna1a	UTSW	8	84549514	missense	probably damaging	1.00
R5223:Cacna1a	UTSW	8	84587195	missense	possibly damaging	0.94
R5408:Cacna1a	UTSW	8	84549707	missense	probably damaging	1.00
R5644:Cacna1a	UTSW	8	84462777	missense	probably damaging	1.00
R5734:Cacna1a	UTSW	8	84583731	missense	probably damaging	0.96
R5786:Cacna1a	UTSW	8	84415721	unclassified	probably benign
R5833:Cacna1a	UTSW	8	84518697	missense	probably damaging	1.00
R5886:Cacna1a	UTSW	8	84523022	missense	probably damaging	0.99
R6049:Cacna1a	UTSW	8	84638846	missense	probably damaging	0.96
R6054:Cacna1a	UTSW	8	84556785	missense	probably damaging	0.99
R6117:Cacna1a	UTSW	8	84614721	missense	probably damaging	1.00
R6149:Cacna1a	UTSW	8	84569952	missense	probably damaging	1.00
R6195:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6233:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6607:Cacna1a	UTSW	8	84579492	missense	probably damaging	1.00
R6753:Cacna1a	UTSW	8	84580205	missense	probably damaging	1.00
R6798:Cacna1a	UTSW	8	84611602	missense	probably damaging	1.00
R6831:Cacna1a	UTSW	8	84571231	missense	probably damaging	1.00
R6980:Cacna1a	UTSW	8	84612285	missense	possibly damaging	0.85
R7051:Cacna1a	UTSW	8	84629915	missense	possibly damaging	0.85
R7270:Cacna1a	UTSW	8	84571237	missense	probably damaging	1.00
R7409:Cacna1a	UTSW	8	84533402	missense	probably damaging	1.00
R7491:Cacna1a	UTSW	8	84559293	missense	possibly damaging	0.92
R7511:Cacna1a	UTSW	8	84567682	missense	possibly damaging	0.75
R7745:Cacna1a	UTSW	8	84559394	missense	probably benign	0.01
R7872:Cacna1a	UTSW	8	84583654	missense	probably damaging	1.00
R7899:Cacna1a	UTSW	8	84594173	missense	possibly damaging	0.72
R7986:Cacna1a	UTSW	8	84638779	missense	probably benign	0.02
R8126:Cacna1a	UTSW	8	84633252	missense	probably benign	0.02
R8266:Cacna1a	UTSW	8	84559219	missense	probably damaging	1.00
R8458:Cacna1a	UTSW	8	84549458	missense	probably damaging	1.00
R8504:Cacna1a	UTSW	8	84638741	missense	probably benign
R8530:Cacna1a	UTSW	8	84612414	critical splice donor site	probably null
R8750:Cacna1a	UTSW	8	84559155	missense	probably damaging	0.99
R8817:Cacna1a	UTSW	8	84638797	missense	probably benign	0.44
R8856:Cacna1a	UTSW	8	84559441	missense	probably benign	0.30
R8893:Cacna1a	UTSW	8	84587135	missense	probably benign	0.00
R9083:Cacna1a	UTSW	8	84617882	missense	probably benign	0.30
R9087:Cacna1a	UTSW	8	84638803	missense	probably benign	0.44
R9118:Cacna1a	UTSW	8	84536086	missense	probably damaging	1.00
R9133:Cacna1a	UTSW	8	84549523	missense	probably damaging	1.00
R9175:Cacna1a	UTSW	8	84570015	missense	probably damaging	0.99
R9233:Cacna1a	UTSW	8	84544654	missense	probably damaging	1.00
R9310:Cacna1a	UTSW	8	84536417	missense	probably damaging	1.00
R9331:Cacna1a	UTSW	8	84415817	missense	probably damaging	1.00
R9334:Cacna1a	UTSW	8	84569965	missense	probably damaging	1.00
R9531:Cacna1a	UTSW	8	84594172	missense	probably benign	0.02
R9532:Cacna1a	UTSW	8	84611617	missense	probably damaging	1.00
R9590:Cacna1a	UTSW	8	84601981	nonsense	probably null
R9710:Cacna1a	UTSW	8	84594179	missense	possibly damaging	0.74
RF029:Cacna1a	UTSW	8	84638724	small insertion	probably benign
X0022:Cacna1a	UTSW	8	84633699	missense	possibly damaging	0.53
Z1176:Cacna1a	UTSW	8	84415676	missense	unknown
Z1177:Cacna1a	UTSW	8	84579491	missense	probably damaging	1.00
Z1188:Cacna1a	UTSW	8	84515054	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCTACACCCAGCGTCTACAGAG -3'
(R):5'- TTCACCCCAACTGGAGAGTCAGAG -3'

Sequencing Primer
(F):5'- TGACCCAGTTCAGAAGGCTC -3'
(R):5'- TCAGAGGGATCATATTCTCAGGC -3'

Posted On

2014-04-13