Incidental Mutation 'R6367:Olfr1148'
ID512728
Institutional Source Beutler Lab
Gene Symbol Olfr1148
Ensembl Gene ENSMUSG00000061875
Gene Nameolfactory receptor 1148
SynonymsGA_x6K02T2Q125-49334566-49335510, MOR264-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6367 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87830533-87835803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87833593 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 185 (C185R)
Ref Sequence ENSEMBL: ENSMUSP00000149438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077580] [ENSMUST00000215230]
Predicted Effect probably damaging
Transcript: ENSMUST00000077580
AA Change: C185R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076778
Gene: ENSMUSG00000061875
AA Change: C185R

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 4.1e-54 PFAM
Pfam:7tm_1 47 296 4.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215230
AA Change: C185R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,216,248 N54D possibly damaging Het
Abca4 A C 3: 122,103,580 Q636P probably damaging Het
Agk T C 6: 40,386,941 F285S probably benign Het
Als2 C A 1: 59,199,140 V678L probably benign Het
Arhgap17 T C 7: 123,308,363 *231W probably null Het
Atp11b A G 3: 35,784,537 T89A probably damaging Het
Axl A T 7: 25,787,433 C50S probably damaging Het
Cachd1 A G 4: 101,002,970 D1246G probably damaging Het
Dip2b A T 15: 100,115,914 Q57L possibly damaging Het
Dnah14 A G 1: 181,755,386 probably null Het
Enpep G T 3: 129,332,081 T134N possibly damaging Het
Ets1 C T 9: 32,733,960 Q168* probably null Het
Fanci T C 7: 79,426,195 C529R probably damaging Het
Fbxw28 A G 9: 109,339,531 probably null Het
Gucy2c C T 6: 136,709,778 E796K probably damaging Het
Igsf9b G A 9: 27,309,525 W62* probably null Het
Kcng1 C A 2: 168,262,652 V425L probably damaging Het
Kndc1 T C 7: 139,913,506 S463P probably damaging Het
Lrba G C 3: 86,368,562 A1746P probably benign Het
Mgat4c G T 10: 102,385,154 probably null Het
Nckap1l G A 15: 103,475,722 M582I probably benign Het
Oacyl G T 18: 65,725,444 R207L probably damaging Het
Olfr1263 A G 2: 90,015,016 I29V probably benign Het
Olfr164 C T 16: 19,286,072 V224M probably damaging Het
Olfr561 C A 7: 102,774,829 Q102K possibly damaging Het
Pacsin2 C T 15: 83,381,832 A55T probably benign Het
Plekhm2 T C 4: 141,639,705 D208G probably damaging Het
Ptpru T C 4: 131,774,352 D1181G probably benign Het
Safb A G 17: 56,593,845 probably benign Het
Scp2 T A 4: 108,112,250 Y35F probably damaging Het
Secisbp2 A G 13: 51,682,141 Y757C probably damaging Het
Sp110 C T 1: 85,594,292 V97M probably benign Het
Ssx2ip A G 3: 146,419,166 Y82C probably benign Het
Svopl A T 6: 38,019,679 W288R possibly damaging Het
Tdg T C 10: 82,647,988 Y345H possibly damaging Het
Tmem109 A G 19: 10,874,363 F53S possibly damaging Het
Tpsab1 G T 17: 25,343,474 T293N probably damaging Het
Trpm8 A G 1: 88,359,683 D796G probably damaging Het
Tuba1c T C 15: 99,037,453 I265T probably damaging Het
Unc80 T C 1: 66,672,766 V2749A probably benign Het
Utrn A G 10: 12,747,975 L173P probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wbp2 G T 11: 116,083,915 T31N probably benign Het
Wdr1 G T 5: 38,545,846 A129D possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Olfr1148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Olfr1148 APN 2 87833500 missense probably damaging 1.00
IGL01893:Olfr1148 APN 2 87833863 nonsense probably null
IGL02247:Olfr1148 APN 2 87833529 missense probably damaging 0.97
IGL02286:Olfr1148 APN 2 87833248 missense probably damaging 0.99
IGL02645:Olfr1148 APN 2 87833615 missense probably benign 0.21
R1304:Olfr1148 UTSW 2 87833705 missense possibly damaging 0.51
R1762:Olfr1148 UTSW 2 87833665 missense probably damaging 0.98
R1770:Olfr1148 UTSW 2 87833299 missense probably benign 0.05
R4308:Olfr1148 UTSW 2 87833270 missense probably damaging 0.99
R4721:Olfr1148 UTSW 2 87833171 missense probably damaging 1.00
R6011:Olfr1148 UTSW 2 87833915 missense probably damaging 1.00
R6225:Olfr1148 UTSW 2 87833317 missense probably benign 0.04
R6243:Olfr1148 UTSW 2 87833041 start codon destroyed probably null 0.00
R7379:Olfr1148 UTSW 2 87833779 missense probably damaging 1.00
R7510:Olfr1148 UTSW 2 87833528 missense probably damaging 0.97
R8003:Olfr1148 UTSW 2 87833737 missense probably benign 0.00
X0050:Olfr1148 UTSW 2 87833534 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTCCTGTGCTACACAACTG -3'
(R):5'- ATGTGGAGAAGGCTTTTCCCC -3'

Sequencing Primer
(F):5'- ATGTCCTATGACCGATATGTGGCC -3'
(R):5'- CCCGACCTTTGGCTGTTGG -3'
Posted On2018-04-27