Incidental Mutation 'R6346:Ubd'
ID 513974
Institutional Source Beutler Lab
Gene Symbol Ubd
Ensembl Gene ENSMUSG00000035186
Gene Name ubiquitin D
Synonyms FAT10, Diubiquitin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6346 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37193892-37196095 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 37195351 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 43 (Q43*)
Ref Sequence ENSEMBL: ENSMUSP00000035808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038844] [ENSMUST00000055324] [ENSMUST00000222190]
AlphaFold P63072
Predicted Effect probably null
Transcript: ENSMUST00000038844
AA Change: Q43*
SMART Domains Protein: ENSMUSP00000035808
Gene: ENSMUSG00000035186
AA Change: Q43*

DomainStartEndE-ValueType
UBQ 5 76 8.61e-9 SMART
UBQ 88 158 9.23e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055324
SMART Domains Protein: ENSMUSP00000055232
Gene: ENSMUSG00000043827

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:7tm_4 105 382 6.5e-39 PFAM
Pfam:7TM_GPCR_Srsx 109 220 2.1e-9 PFAM
Pfam:7tm_1 115 365 3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208047
Predicted Effect probably benign
Transcript: ENSMUST00000222190
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice hompzygous for disruptions in this gene show an increased susceptibility to low doses of endotoxin and increased apoptosis among lymphocytes but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Apbb1ip T G 2: 22,866,993 probably null Het
Arhgap18 A T 10: 26,846,065 I11F probably damaging Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Fam20c T C 5: 138,766,695 F279S probably damaging Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Ksr1 A C 11: 79,019,664 L814R possibly damaging Het
Lmnb1 A G 18: 56,743,238 I473V probably benign Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Ntn4 A T 10: 93,644,861 D112V probably damaging Het
Nup43 T A 10: 7,675,062 V232D probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Senp5 A G 16: 31,983,847 Y508H probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Ubd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02626:Ubd APN 17 37195682 missense probably damaging 1.00
IGL02668:Ubd APN 17 37195529 missense probably benign 0.07
IGL02725:Ubd APN 17 37193962 missense probably benign 0.14
PIT4696001:Ubd UTSW 17 37195444 missense probably damaging 1.00
R1163:Ubd UTSW 17 37195321 missense probably damaging 0.99
R4731:Ubd UTSW 17 37195702 missense probably benign 0.05
R4732:Ubd UTSW 17 37195702 missense probably benign 0.05
R4733:Ubd UTSW 17 37195702 missense probably benign 0.05
R5648:Ubd UTSW 17 37195454 missense probably damaging 1.00
R6332:Ubd UTSW 17 37195501 missense probably benign 0.01
R7687:Ubd UTSW 17 37193974 critical splice donor site probably null
R8395:Ubd UTSW 17 37195358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTGTTGAGAAGGAGCC -3'
(R):5'- TGAGCTGGATCTTCGAACTCG -3'

Sequencing Primer
(F):5'- CCAACCAGGAGAACAGTGAAGC -3'
(R):5'- ATCTTCGAACTCGGAGGAGGTG -3'
Posted On 2018-04-27