Incidental Mutation 'R6420:Olfr1085'
ID518140
Institutional Source Beutler Lab
Gene Symbol Olfr1085
Ensembl Gene ENSMUSG00000075176
Gene Nameolfactory receptor 1085
SynonymsGA_x6K02T2Q125-48147264-48146323, MOR191-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6420 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86653665-86662019 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86658166 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 97 (C97*)
Ref Sequence ENSEMBL: ENSMUSP00000150955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099879] [ENSMUST00000213279] [ENSMUST00000214566]
Predicted Effect probably null
Transcript: ENSMUST00000099879
AA Change: C97*
SMART Domains Protein: ENSMUSP00000097464
Gene: ENSMUSG00000075176
AA Change: C97*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.6e-49 PFAM
Pfam:7tm_1 41 290 1.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213279
AA Change: C97*
Predicted Effect probably null
Transcript: ENSMUST00000214566
AA Change: C97*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,398 I117N probably damaging Het
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Dhx16 A G 17: 35,883,014 E367G possibly damaging Het
Epc2 T C 2: 49,451,900 V32A probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hdlbp T C 1: 93,431,004 E275G probably damaging Het
Kdm7a T C 6: 39,165,168 D392G probably damaging Het
Lgmn T A 12: 102,423,719 R4* probably null Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Mup1 C G 4: 60,501,759 E31Q possibly damaging Het
Nckap1l G C 15: 103,491,466 G1025A possibly damaging Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pik3r5 G A 11: 68,475,424 W42* probably null Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Rad1 T C 15: 10,488,012 V74A probably benign Het
Scara3 C T 14: 65,938,252 G22D possibly damaging Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Sema5b T A 16: 35,663,146 D1051E probably benign Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Spag9 T C 11: 94,086,302 V78A probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Zfp62 A T 11: 49,216,513 N477I probably damaging Het
Zfp846 T C 9: 20,593,711 L289P probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Olfr1085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Olfr1085 APN 2 86657726 missense probably damaging 0.98
IGL01137:Olfr1085 APN 2 86657711 missense possibly damaging 0.92
IGL01329:Olfr1085 APN 2 86658207 missense probably benign 0.31
IGL01398:Olfr1085 APN 2 86657688 missense probably damaging 1.00
IGL02248:Olfr1085 APN 2 86657717 missense probably damaging 1.00
IGL02699:Olfr1085 APN 2 86658347 missense probably benign 0.34
IGL02818:Olfr1085 APN 2 86657784 missense probably damaging 1.00
IGL03095:Olfr1085 APN 2 86658431 missense possibly damaging 0.50
IGL03218:Olfr1085 APN 2 86658359 missense probably benign 0.32
R0121:Olfr1085 UTSW 2 86657819 missense probably benign 0.42
R0546:Olfr1085 UTSW 2 86657891 missense possibly damaging 0.91
R0583:Olfr1085 UTSW 2 86658360 missense probably benign 0.20
R0980:Olfr1085 UTSW 2 86657865 missense probably benign 0.39
R2067:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R2111:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R3760:Olfr1085 UTSW 2 86657888 missense possibly damaging 0.91
R4530:Olfr1085 UTSW 2 86657561 missense probably benign 0.00
R4809:Olfr1085 UTSW 2 86657685 missense possibly damaging 0.95
R5940:Olfr1085 UTSW 2 86658050 missense probably damaging 0.98
R6027:Olfr1085 UTSW 2 86657804 missense probably damaging 1.00
R6417:Olfr1085 UTSW 2 86658166 nonsense probably null
R6619:Olfr1085 UTSW 2 86658062 missense probably damaging 1.00
R6762:Olfr1085 UTSW 2 86657844 missense probably benign 0.22
R6946:Olfr1085 UTSW 2 86657588 missense probably damaging 1.00
R7673:Olfr1085 UTSW 2 86657726 missense probably damaging 1.00
R7718:Olfr1085 UTSW 2 86658029 missense probably benign 0.26
R8461:Olfr1085 UTSW 2 86657546 missense probably benign 0.02
R8506:Olfr1085 UTSW 2 86658401 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AACCTCATGTGTATTTGAACAGAGC -3'
(R):5'- GCAGTGGGTAATTTAGGCATCATC -3'

Sequencing Primer
(F):5'- TTGAACAGAGCAAAGATATTAATGGG -3'
(R):5'- CATTATTACTAATGTGGACTCCAGTC -3'
Posted On2018-05-24