Mutagenetix > Incidental Mutations

Incidental Mutation 'R6420:Olfr1085'

518140

Institutional Source

Beutler Lab

Gene Symbol

Olfr1085

Ensembl Gene

ENSMUSG00000075176

Gene Name

olfactory receptor 1085

Synonyms

GA_x6K02T2Q125-48147264-48146323, MOR191-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6420 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86653665-86662019 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 86658166 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 97 (C97*)

Ref Sequence

ENSEMBL: ENSMUSP00000150955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099879] [ENSMUST00000213279] [ENSMUST00000214566]

Predicted Effect

probably null
Transcript: ENSMUST00000099879
AA Change: C97*

SMART Domains

Protein: ENSMUSP00000097464
Gene: ENSMUSG00000075176
AA Change: C97*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	4.6e-49	PFAM
Pfam:7tm_1	41	290	1.1e-18	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000213279
AA Change: C97*

Predicted Effect

probably null
Transcript: ENSMUST00000214566
AA Change: C97*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	T	17: 48,166,398	I117N	probably damaging	Het
Abca15	A	G	7: 120,397,128	K1426E	possibly damaging	Het
Arhgef17	A	G	7: 100,930,062	S560P	probably damaging	Het
Asb13	G	A	13: 3,643,574	V111I	probably damaging	Het
Dhx16	A	G	17: 35,883,014	E367G	possibly damaging	Het
Epc2	T	C	2: 49,451,900	V32A	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Hdlbp	T	C	1: 93,431,004	E275G	probably damaging	Het
Kdm7a	T	C	6: 39,165,168	D392G	probably damaging	Het
Lgmn	T	A	12: 102,423,719	R4*	probably null	Het
Lrrk2	C	T	15: 91,812,346	R2446C	probably benign	Het
Map3k10	A	G	7: 27,663,284	F459S	probably damaging	Het
Mup1	C	G	4: 60,501,759	E31Q	possibly damaging	Het
Nckap1l	G	C	15: 103,491,466	G1025A	possibly damaging	Het
Olfr1425	T	G	19: 12,073,960	K224T	probably benign	Het
Olfr1449	A	C	19: 12,935,220	T161P	probably damaging	Het
Olfr887	T	A	9: 38,085,594	S253T	probably benign	Het
Olfr890	T	G	9: 38,143,315	L55R	probably damaging	Het
Pik3r5	G	A	11: 68,475,424	W42*	probably null	Het
Pkd1l2	C	T	8: 117,013,899	C2153Y	probably damaging	Het
Rad1	T	C	15: 10,488,012	V74A	probably benign	Het
Scara3	C	T	14: 65,938,252	G22D	possibly damaging	Het
Scn1a	A	G	2: 66,273,198	I1906T	probably damaging	Het
Sema5b	T	A	16: 35,663,146	D1051E	probably benign	Het
Slc16a12	T	C	19: 34,672,697		probably null	Het
Slc25a23	T	C	17: 57,052,780	I324V	probably damaging	Het
Sord	A	T	2: 122,264,121	K330M	possibly damaging	Het
Spag9	T	C	11: 94,086,302	V78A	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tnrc6a	A	G	7: 123,171,074	T696A	probably benign	Het
Ttn	A	G	2: 76,712,275	Y33456H	possibly damaging	Het
Unc45a	C	G	7: 80,339,652	E23Q	probably benign	Het
Urb2	C	T	8: 124,047,199	R1490W	probably damaging	Het
Zfp62	A	T	11: 49,216,513	N477I	probably damaging	Het
Zfp846	T	C	9: 20,593,711	L289P	probably damaging	Het
Zfp959	G	A	17: 55,898,094	G377D	probably damaging	Het
Zswim3	G	A	2: 164,820,733	V378M	probably damaging	Het

Other mutations in Olfr1085

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00940:Olfr1085	APN	2	86657726	missense	probably damaging	0.98
IGL01137:Olfr1085	APN	2	86657711	missense	possibly damaging	0.92
IGL01329:Olfr1085	APN	2	86658207	missense	probably benign	0.31
IGL01398:Olfr1085	APN	2	86657688	missense	probably damaging	1.00
IGL02248:Olfr1085	APN	2	86657717	missense	probably damaging	1.00
IGL02699:Olfr1085	APN	2	86658347	missense	probably benign	0.34
IGL02818:Olfr1085	APN	2	86657784	missense	probably damaging	1.00
IGL03095:Olfr1085	APN	2	86658431	missense	possibly damaging	0.50
IGL03218:Olfr1085	APN	2	86658359	missense	probably benign	0.32
R0121:Olfr1085	UTSW	2	86657819	missense	probably benign	0.42
R0546:Olfr1085	UTSW	2	86657891	missense	possibly damaging	0.91
R0583:Olfr1085	UTSW	2	86658360	missense	probably benign	0.20
R0980:Olfr1085	UTSW	2	86657865	missense	probably benign	0.39
R2067:Olfr1085	UTSW	2	86658437	missense	probably damaging	1.00
R2111:Olfr1085	UTSW	2	86658437	missense	probably damaging	1.00
R3760:Olfr1085	UTSW	2	86657888	missense	possibly damaging	0.91
R4530:Olfr1085	UTSW	2	86657561	missense	probably benign	0.00
R4809:Olfr1085	UTSW	2	86657685	missense	possibly damaging	0.95
R5940:Olfr1085	UTSW	2	86658050	missense	probably damaging	0.98
R6027:Olfr1085	UTSW	2	86657804	missense	probably damaging	1.00
R6417:Olfr1085	UTSW	2	86658166	nonsense	probably null
R6619:Olfr1085	UTSW	2	86658062	missense	probably damaging	1.00
R6762:Olfr1085	UTSW	2	86657844	missense	probably benign	0.22
R6946:Olfr1085	UTSW	2	86657588	missense	probably damaging	1.00
R7673:Olfr1085	UTSW	2	86657726	missense	probably damaging	1.00
R7718:Olfr1085	UTSW	2	86658029	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- AACCTCATGTGTATTTGAACAGAGC -3'
(R):5'- GCAGTGGGTAATTTAGGCATCATC -3'

Sequencing Primer
(F):5'- TTGAACAGAGCAAAGATATTAATGGG -3'
(R):5'- CATTATTACTAATGTGGACTCCAGTC -3'

Posted On

2018-05-24