Incidental Mutation 'R6420:Lgmn'
ID518159
Institutional Source Beutler Lab
Gene Symbol Lgmn
Ensembl Gene ENSMUSG00000021190
Gene Namelegumain
SynonymsPrsc1, preprolegumain, AEP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6420 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location102394084-102439813 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 102423719 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 4 (R4*)
Ref Sequence ENSEMBL: ENSMUSP00000105647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021607] [ENSMUST00000110020]
Predicted Effect probably null
Transcript: ENSMUST00000021607
AA Change: R4*
SMART Domains Protein: ENSMUSP00000021607
Gene: ENSMUSG00000021190
AA Change: R4*

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110020
AA Change: R4*
SMART Domains Protein: ENSMUSP00000105647
Gene: ENSMUSG00000021190
AA Change: R4*

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine peptidase family C13 that plays an important role in the endosome/lysosomal degradation system. The encoded inactive preproprotein undergoes autocatalytic removal of the C-terminal inhibitory propeptide to generate the active endopeptidase that cleaves protein substrates on the C-terminal side of asparagine residues. Mice lacking the encoded protein exhibit defects in the lysosomal processing of proteins resulting in their accumulation in the lysosomes, and develop symptoms resembling hemophagocytic lymphohistiocytosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit slow postnatal weight gain, develop features of hemophagocytic syndrome, and accumulate giant lysosomes in renal tubule cells. Homozygotes for another null allele display impaired TLR9 signaling in dendritic cells, progressive kidney pathology, and proteinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,398 I117N probably damaging Het
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Dhx16 A G 17: 35,883,014 E367G possibly damaging Het
Epc2 T C 2: 49,451,900 V32A probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hdlbp T C 1: 93,431,004 E275G probably damaging Het
Kdm7a T C 6: 39,165,168 D392G probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Mup1 C G 4: 60,501,759 E31Q possibly damaging Het
Nckap1l G C 15: 103,491,466 G1025A possibly damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pik3r5 G A 11: 68,475,424 W42* probably null Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Rad1 T C 15: 10,488,012 V74A probably benign Het
Scara3 C T 14: 65,938,252 G22D possibly damaging Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Sema5b T A 16: 35,663,146 D1051E probably benign Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Spag9 T C 11: 94,086,302 V78A probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Zfp62 A T 11: 49,216,513 N477I probably damaging Het
Zfp846 T C 9: 20,593,711 L289P probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Lgmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Lgmn APN 12 102398176 splice site probably benign
IGL02069:Lgmn APN 12 102404299 missense possibly damaging 0.92
IGL02150:Lgmn APN 12 102395727 missense possibly damaging 0.80
IGL02228:Lgmn APN 12 102395714 missense probably benign 0.04
IGL02637:Lgmn APN 12 102400226 missense probably damaging 0.98
Getz UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0988:Lgmn UTSW 12 102398277 missense probably damaging 0.99
R1451:Lgmn UTSW 12 102405892 splice site probably benign
R1568:Lgmn UTSW 12 102394609 missense possibly damaging 0.95
R1944:Lgmn UTSW 12 102401924 missense probably damaging 1.00
R1972:Lgmn UTSW 12 102395821 unclassified probably benign
R2133:Lgmn UTSW 12 102394908 missense probably damaging 1.00
R2298:Lgmn UTSW 12 102395678 missense probably damaging 0.99
R3846:Lgmn UTSW 12 102404329 missense possibly damaging 0.87
R4610:Lgmn UTSW 12 102400124 splice site probably benign
R4788:Lgmn UTSW 12 102402677 missense probably benign 0.11
R5050:Lgmn UTSW 12 102403421 splice site probably null
R5708:Lgmn UTSW 12 102404328 missense possibly damaging 0.87
R5969:Lgmn UTSW 12 102405827 missense probably damaging 1.00
R6090:Lgmn UTSW 12 102400154 missense probably damaging 1.00
R6496:Lgmn UTSW 12 102398239 missense probably benign 0.01
R6592:Lgmn UTSW 12 102404270 missense probably damaging 1.00
R6659:Lgmn UTSW 12 102402692 missense probably benign 0.03
R7063:Lgmn UTSW 12 102402678 missense probably damaging 1.00
R7336:Lgmn UTSW 12 102423739 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGAATGGCCATTTTGTAGGCAC -3'
(R):5'- TGCACAAATAGTTCAGGGATTGG -3'

Sequencing Primer
(F):5'- GCACAAAGCCAGTGACAAG -3'
(R):5'- GCTATCTGCATTCTGAGTTGAAAAG -3'
Posted On2018-05-24