Incidental Mutation 'R6540:Sik3'
ID520698
Institutional Source Beutler Lab
Gene Symbol Sik3
Ensembl Gene ENSMUSG00000034135
Gene NameSIK family kinase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6540 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location46012820-46224194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46212053 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1050 (H1050R)
Ref Sequence ENSEMBL: ENSMUSP00000121032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120463] [ENSMUST00000126865]
Predicted Effect unknown
Transcript: ENSMUST00000120247
AA Change: H894R
SMART Domains Protein: ENSMUSP00000112859
Gene: ENSMUSG00000034135
AA Change: H894R

DomainStartEndE-ValueType
S_TKc 19 270 5.4e-102 SMART
internal_repeat_1 349 392 8.97e-6 PROSPERO
low complexity region 436 445 N/A INTRINSIC
internal_repeat_1 492 536 8.97e-6 PROSPERO
low complexity region 602 613 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120463
AA Change: H1000R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112749
Gene: ENSMUSG00000034135
AA Change: H1000R

DomainStartEndE-ValueType
low complexity region 1 53 N/A INTRINSIC
S_TKc 64 315 5.4e-102 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
low complexity region 673 693 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 830 843 N/A INTRINSIC
low complexity region 894 907 N/A INTRINSIC
low complexity region 996 1011 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126865
AA Change: H1050R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121032
Gene: ENSMUSG00000034135
AA Change: H1050R

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
S_TKc 66 317 5.4e-102 SMART
internal_repeat_1 444 487 1.55e-6 PROSPERO
low complexity region 531 540 N/A INTRINSIC
internal_repeat_1 587 631 1.55e-6 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 723 743 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 880 893 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1046 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153152
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired chondrocyte hypertrophy during development, neonatal lethality and reduced size. Mice homozygous for a gain of function ENU mutation exhibit decreased total wake time, owing to an increase in inherent sleep need. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,766,986 Y143H possibly damaging Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adamts2 T C 11: 50,788,740 V849A possibly damaging Het
AF366264 A C 8: 13,837,573 S173A probably benign Het
Ash1l A T 3: 88,985,061 T1416S probably damaging Het
Cdc5l A G 17: 45,426,644 W63R probably damaging Het
Cep95 T A 11: 106,801,502 D169E probably damaging Het
Col14a1 A C 15: 55,372,581 N297T unknown Het
Cp T C 3: 19,964,529 probably null Het
Fbxl19 G T 7: 127,748,353 probably benign Het
Flnc T C 6: 29,446,377 V931A possibly damaging Het
Foxj2 A G 6: 122,833,243 H187R probably benign Het
Hectd4 G A 5: 121,303,571 V1199I probably benign Het
Ighv7-4 A G 12: 114,222,850 Y101H possibly damaging Het
Igkv10-94 T A 6: 68,704,523 Y111F probably benign Het
Lin28a C T 4: 134,018,061 V74M possibly damaging Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mroh9 T G 1: 163,038,972 T701P possibly damaging Het
Ndst4 A T 3: 125,722,152 K309* probably null Het
Nlrp9a T C 7: 26,557,392 V145A possibly damaging Het
Olfr167 T C 16: 19,514,821 I272V probably benign Het
Ovgp1 A T 3: 105,986,581 K557* probably null Het
Pde4b T C 4: 102,601,876 L546P probably damaging Het
Pkd1 G A 17: 24,575,977 V2213M probably damaging Het
Plekhh1 A G 12: 79,064,489 I542V probably benign Het
Ppan A G 9: 20,891,210 probably null Het
Prdm15 A T 16: 97,835,805 V104E probably benign Het
Slc35d3 A G 10: 19,849,340 F257L possibly damaging Het
Tfip11 A G 5: 112,334,397 probably null Het
Tmem132d A G 5: 128,268,532 S309P possibly damaging Het
Tmem87a T C 2: 120,403,919 I48V probably benign Het
V1rd19 T A 7: 24,003,631 L174* probably null Het
Zfp729a A G 13: 67,619,648 C821R possibly damaging Het
Zfp970 C A 2: 177,475,595 H321N probably damaging Het
Zzef1 T C 11: 72,913,229 L2599P probably damaging Het
Other mutations in Sik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Sik3 APN 9 46211726 missense probably benign 0.37
IGL02957:Sik3 APN 9 46195845 missense possibly damaging 0.90
IGL03052:Sik3 UTSW 9 46198149 missense probably damaging 0.97
PIT4515001:Sik3 UTSW 9 46208731 missense probably damaging 1.00
R0119:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0299:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0344:Sik3 UTSW 9 46208811 missense probably damaging 0.97
R0411:Sik3 UTSW 9 46208770 missense probably damaging 0.99
R0499:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0745:Sik3 UTSW 9 46198239 missense probably benign 0.10
R1017:Sik3 UTSW 9 46195809 missense probably benign 0.00
R1310:Sik3 UTSW 9 46219426 missense possibly damaging 0.81
R1355:Sik3 UTSW 9 46195872 critical splice donor site probably benign
R1406:Sik3 UTSW 9 46123345 splice site probably benign
R1457:Sik3 UTSW 9 46221148 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46202022 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1852:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1883:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1884:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1903:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1918:Sik3 UTSW 9 46221089 missense probably benign 0.00
R2077:Sik3 UTSW 9 46219503 missense probably damaging 1.00
R2379:Sik3 UTSW 9 46155409 missense probably damaging 1.00
R3791:Sik3 UTSW 9 46194822 missense possibly damaging 0.94
R3809:Sik3 UTSW 9 46219486 missense probably benign 0.05
R3955:Sik3 UTSW 9 46198593 missense probably damaging 1.00
R3980:Sik3 UTSW 9 46202063 missense probably damaging 1.00
R4753:Sik3 UTSW 9 46198214 missense probably damaging 0.99
R5195:Sik3 UTSW 9 46208844 critical splice donor site probably null
R5256:Sik3 UTSW 9 46212254 missense probably damaging 0.99
R5432:Sik3 UTSW 9 46123241 missense probably benign 0.45
R5985:Sik3 UTSW 9 46211675 missense probably damaging 1.00
R6310:Sik3 UTSW 9 46178486 missense probably damaging 1.00
R6732:Sik3 UTSW 9 46212553 missense probably benign 0.02
R6812:Sik3 UTSW 9 46210769 missense probably damaging 1.00
R7069:Sik3 UTSW 9 46210743 missense probably damaging 1.00
R7830:Sik3 UTSW 9 46212057 small deletion probably benign
R7875:Sik3 UTSW 9 46123230 missense probably damaging 1.00
X0017:Sik3 UTSW 9 46212499 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTCCTCCGCTTGACCAG -3'
(R):5'- GCGCCCTGATCTGTAAGATATG -3'

Sequencing Primer
(F):5'- GCTTGACCAGTTCCCCAC -3'
(R):5'- CCCTGATCTGTAAGATATGCTGGG -3'
Posted On2018-06-06