Incidental Mutation 'R6551:Tamm41'
ID521612
Institutional Source Beutler Lab
Gene Symbol Tamm41
Ensembl Gene ENSMUSG00000030316
Gene NameTAM41 mitochondrial translocator assembly and maintenance homolog
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R6551 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location115004381-115037876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115012181 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 284 (D284G)
Ref Sequence ENSEMBL: ENSMUSP00000032461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032461] [ENSMUST00000154621] [ENSMUST00000172495] [ENSMUST00000174848]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032461
AA Change: D284G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032461
Gene: ENSMUSG00000030316
AA Change: D284G

DomainStartEndE-ValueType
Pfam:Mmp37 13 327 9.9e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144969
Predicted Effect probably benign
Transcript: ENSMUST00000154621
SMART Domains Protein: ENSMUSP00000116995
Gene: ENSMUSG00000030316

DomainStartEndE-ValueType
Pfam:Mmp37 12 109 8.6e-40 PFAM
low complexity region 130 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172495
SMART Domains Protein: ENSMUSP00000134105
Gene: ENSMUSG00000030316

DomainStartEndE-ValueType
Pfam:Mmp37 1 124 2.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174848
SMART Domains Protein: ENSMUSP00000133340
Gene: ENSMUSG00000030316

DomainStartEndE-ValueType
Pfam:Mmp37 12 188 3.2e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A T 1: 193,174,523 Q61L probably damaging Het
Acss2 T C 2: 155,551,208 S285P probably benign Het
Ager A G 17: 34,599,468 probably null Het
Alkbh7 T A 17: 56,998,945 Y115* probably null Het
Brwd1 T C 16: 95,993,962 D2184G possibly damaging Het
Chp1 T A 2: 119,571,813 H89Q possibly damaging Het
Clmp T C 9: 40,771,277 V119A probably benign Het
Cryge A T 1: 65,048,637 M171K probably benign Het
Cttnbp2nl A T 3: 105,005,117 S484T possibly damaging Het
Dsg3 C A 18: 20,539,911 P880T unknown Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Espn T C 4: 152,128,766 Het
Fbxo31 A C 8: 121,564,704 probably benign Het
Grin2b A G 6: 135,733,344 V1068A probably damaging Het
Jak1 C A 4: 101,193,843 probably benign Het
Klra10 A T 6: 130,275,755 D185E probably benign Het
Lhx1 A C 11: 84,521,913 D60E probably benign Het
Lyar C A 5: 38,233,272 A326D probably damaging Het
Muc16 A C 9: 18,562,562 S1280A possibly damaging Het
Nol9 G A 4: 152,051,868 V466I possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1120 T C 2: 87,846,661 V130A possibly damaging Het
Olfr1380 G T 11: 49,563,989 V23L probably benign Het
Olfr23 T C 11: 73,940,303 I19T probably benign Het
Olfr317 A T 11: 58,732,757 M136K probably damaging Het
Olfr959 C A 9: 39,572,560 R233L probably benign Het
Pik3c2a A T 7: 116,417,496 I342N probably damaging Het
Pnldc1 A G 17: 12,905,569 M133T probably damaging Het
Rab11fip1 G A 8: 27,156,484 S188L probably damaging Het
Rapgef2 A T 3: 79,215,035 probably null Het
Rnf103 G A 6: 71,510,365 C660Y probably damaging Het
Rph3al G A 11: 75,906,546 S108F possibly damaging Het
Srsf7 A C 17: 80,204,219 probably benign Het
Ssrp1 A G 2: 85,041,106 probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem39b A G 4: 129,692,103 V25A probably benign Het
Tmem88b G T 4: 155,785,692 probably benign Het
Unk T C 11: 116,050,724 W266R probably damaging Het
Usp8 T A 2: 126,733,182 probably benign Het
Zbtb48 T G 4: 152,022,221 Q142P probably benign Het
Zdhhc18 T C 4: 133,613,649 T267A probably benign Het
Zfp335 G A 2: 164,909,365 P94S probably benign Het
Other mutations in Tamm41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Tamm41 APN 6 115016098 missense probably benign 0.00
R0101:Tamm41 UTSW 6 115032246 missense probably damaging 1.00
R2045:Tamm41 UTSW 6 115016095 missense probably benign 0.07
R4207:Tamm41 UTSW 6 115012359 intron probably benign
R4208:Tamm41 UTSW 6 115012359 intron probably benign
R4627:Tamm41 UTSW 6 115035002 missense probably benign 0.18
R4820:Tamm41 UTSW 6 115025417 missense possibly damaging 0.94
R7727:Tamm41 UTSW 6 115016178 missense probably damaging 1.00
X0058:Tamm41 UTSW 6 115035021 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGAGATTTGGAAAACCCCGAATTG -3'
(R):5'- TGTGTCCGACTAGCTGTGTC -3'

Sequencing Primer
(F):5'- TGGAAAACCCCGAATTGTTCATGC -3'
(R):5'- ACTAGCTGTGTCTAGACTTCAGAGC -3'
Posted On2018-06-06