Incidental Mutation 'R6627:Tmem57'
ID524852
Institutional Source Beutler Lab
Gene Symbol Tmem57
Ensembl Gene ENSMUSG00000028826
Gene Nametransmembrane protein 57
Synonyms1110007C24Rik, C61, 9230118A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.690) question?
Stock #R6627 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location134802759-134853345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134836343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 110 (V110A)
Ref Sequence ENSEMBL: ENSMUSP00000030628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030628] [ENSMUST00000137707] [ENSMUST00000148595]
Predicted Effect probably damaging
Transcript: ENSMUST00000030628
AA Change: V110A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030628
Gene: ENSMUSG00000028826
AA Change: V110A

DomainStartEndE-ValueType
Pfam:Macoilin 2 662 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136113
Predicted Effect probably damaging
Transcript: ENSMUST00000137707
AA Change: V110A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124477
Gene: ENSMUSG00000028826
AA Change: V110A

DomainStartEndE-ValueType
Pfam:Macoilin 2 157 2.1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148595
SMART Domains Protein: ENSMUSP00000125440
Gene: ENSMUSG00000028826

DomainStartEndE-ValueType
Pfam:Macoilin 2 78 7e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 T C 18: 12,262,164 N224S probably benign Het
Ccdc162 A G 10: 41,663,185 S396P probably damaging Het
Cd9 A G 6: 125,462,412 L119P possibly damaging Het
Cdk17 A C 10: 93,232,412 T311P probably damaging Het
Cep89 A G 7: 35,427,747 D511G possibly damaging Het
Coq3 T C 4: 21,908,607 V286A possibly damaging Het
Cyp2j13 G A 4: 96,059,106 T236I probably damaging Het
Ddx46 T C 13: 55,652,935 V301A probably benign Het
Dnah10 A T 5: 124,830,033 I4209F probably damaging Het
E2f5 G A 3: 14,603,857 E270K probably benign Het
Esp24 C T 17: 39,040,061 Q51* probably null Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fasn G T 11: 120,818,927 Q435K probably benign Het
Gpr17 T C 18: 31,947,896 Y38C probably damaging Het
Ikbkap A T 4: 56,784,647 probably null Het
Lfng T C 5: 140,607,768 V118A probably damaging Het
Muc5ac T C 7: 141,808,690 probably benign Het
Myh1 T G 11: 67,215,009 L1150R probably damaging Het
Plod3 T G 5: 136,988,456 I111S probably damaging Het
Sh2d4a T A 8: 68,294,318 V66D probably damaging Het
Simc1 T G 13: 54,547,074 L323V probably damaging Het
Thnsl2 A G 6: 71,134,215 I223T possibly damaging Het
Tmem203 T C 2: 25,255,773 probably null Het
Tmppe A G 9: 114,405,485 D284G probably damaging Het
Ube2s C T 7: 4,810,582 R61H possibly damaging Het
Other mutations in Tmem57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Tmem57 APN 4 134828206 missense probably damaging 0.96
IGL01062:Tmem57 APN 4 134833297 missense probably damaging 0.97
IGL02249:Tmem57 APN 4 134828312 missense possibly damaging 0.50
IGL02850:Tmem57 APN 4 134828386 missense probably benign 0.12
subtle UTSW 4 134828299 missense probably damaging 1.00
R0400:Tmem57 UTSW 4 134828116 missense probably benign 0.25
R0548:Tmem57 UTSW 4 134806660 missense probably damaging 1.00
R0589:Tmem57 UTSW 4 134828217 missense probably benign 0.30
R1536:Tmem57 UTSW 4 134804507 missense probably damaging 1.00
R2063:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
R2151:Tmem57 UTSW 4 134811223 missense probably benign 0.00
R2509:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2510:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2511:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R3806:Tmem57 UTSW 4 134830580 missense probably benign 0.00
R3946:Tmem57 UTSW 4 134804481 missense probably damaging 1.00
R4994:Tmem57 UTSW 4 134828299 missense probably damaging 1.00
R4999:Tmem57 UTSW 4 134828133 missense probably benign 0.23
R5169:Tmem57 UTSW 4 134828463 missense probably benign 0.23
R5310:Tmem57 UTSW 4 134837019 intron probably benign
R5443:Tmem57 UTSW 4 134833308 nonsense probably null
R5554:Tmem57 UTSW 4 134828134 missense probably benign
R5712:Tmem57 UTSW 4 134828058 missense probably benign 0.06
R7100:Tmem57 UTSW 4 134806660 missense probably damaging 1.00
R7448:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
R8059:Tmem57 UTSW 4 134828048 nonsense probably null
R8300:Tmem57 UTSW 4 134828451 missense probably benign
X0062:Tmem57 UTSW 4 134836347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCATGCATGCAAGCGAG -3'
(R):5'- GCAAGCTTATAACCACTGCTTCC -3'

Sequencing Primer
(F):5'- GCCAGGCCTACATAGTGAGTTAC -3'
(R):5'- CTGTCTTTAGGCCTTCTCAG -3'
Posted On2018-06-22