Incidental Mutation 'R6627:Ankrd29'
ID524888
Institutional Source Beutler Lab
Gene Symbol Ankrd29
Ensembl Gene ENSMUSG00000057766
Gene Nameankyrin repeat domain 29
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R6627 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12252362-12305720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12262164 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 224 (N224S)
Ref Sequence ENSEMBL: ENSMUSP00000114028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118525] [ENSMUST00000122408]
Predicted Effect probably benign
Transcript: ENSMUST00000118525
AA Change: N224S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000114028
Gene: ENSMUSG00000057766
AA Change: N224S

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
ANK 242 271 3.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122408
AA Change: N224S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112888
Gene: ENSMUSG00000057766
AA Change: N224S

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137948
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc162 A G 10: 41,663,185 S396P probably damaging Het
Cd9 A G 6: 125,462,412 L119P possibly damaging Het
Cdk17 A C 10: 93,232,412 T311P probably damaging Het
Cep89 A G 7: 35,427,747 D511G possibly damaging Het
Coq3 T C 4: 21,908,607 V286A possibly damaging Het
Cyp2j13 G A 4: 96,059,106 T236I probably damaging Het
Ddx46 T C 13: 55,652,935 V301A probably benign Het
Dnah10 A T 5: 124,830,033 I4209F probably damaging Het
E2f5 G A 3: 14,603,857 E270K probably benign Het
Esp24 C T 17: 39,040,061 Q51* probably null Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fasn G T 11: 120,818,927 Q435K probably benign Het
Gpr17 T C 18: 31,947,896 Y38C probably damaging Het
Ikbkap A T 4: 56,784,647 probably null Het
Lfng T C 5: 140,607,768 V118A probably damaging Het
Muc5ac T C 7: 141,808,690 probably benign Het
Myh1 T G 11: 67,215,009 L1150R probably damaging Het
Plod3 T G 5: 136,988,456 I111S probably damaging Het
Sh2d4a T A 8: 68,294,318 V66D probably damaging Het
Simc1 T G 13: 54,547,074 L323V probably damaging Het
Thnsl2 A G 6: 71,134,215 I223T possibly damaging Het
Tmem203 T C 2: 25,255,773 probably null Het
Tmem57 A G 4: 134,836,343 V110A probably damaging Het
Tmppe A G 9: 114,405,485 D284G probably damaging Het
Ube2s C T 7: 4,810,582 R61H possibly damaging Het
Other mutations in Ankrd29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Ankrd29 APN 18 12275738 missense probably benign 0.00
IGL02956:Ankrd29 APN 18 12260936 missense probably damaging 1.00
R0456:Ankrd29 UTSW 18 12295979 missense probably damaging 1.00
R2879:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3693:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3694:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3699:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3700:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4130:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4132:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4745:Ankrd29 UTSW 18 12254622 missense probably benign 0.00
R4989:Ankrd29 UTSW 18 12262185 missense probably damaging 1.00
R5531:Ankrd29 UTSW 18 12279778 missense probably damaging 1.00
R5985:Ankrd29 UTSW 18 12279775 missense probably damaging 1.00
R6187:Ankrd29 UTSW 18 12279690 nonsense probably null
R6895:Ankrd29 UTSW 18 12260989 missense probably benign 0.36
R7671:Ankrd29 UTSW 18 12260986 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTAGGAGGCTGTTCTATTTACCACC -3'
(R):5'- TCACGCACTATGGATGGCATC -3'

Sequencing Primer
(F):5'- CTCCCTGCTTCCACCTGGAG -3'
(R):5'- GGATGGCATCCTCACACAG -3'
Posted On2018-06-22