Incidental Mutation 'R6639:Vmn1r22'
ID525653
Institutional Source Beutler Lab
Gene Symbol Vmn1r22
Ensembl Gene ENSMUSG00000115091
Gene Namevomeronasal 1 receptor 22
SynonymsV1rc23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6639 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location57898126-57908028 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57900714 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 93 (I93V)
Ref Sequence ENSEMBL: ENSMUSP00000154301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177435] [ENSMUST00000227342] [ENSMUST00000227650] [ENSMUST00000228076] [ENSMUST00000228257] [ENSMUST00000228322] [ENSMUST00000228905]
Predicted Effect probably benign
Transcript: ENSMUST00000177435
AA Change: I93V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135207
Gene: ENSMUSG00000114982
AA Change: I93V

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227342
Predicted Effect probably benign
Transcript: ENSMUST00000227650
AA Change: I93V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228076
AA Change: I93V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228257
AA Change: I93V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228322
AA Change: I93V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228905
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,530 S226P probably benign Het
Adgb T G 10: 10,435,956 I238L possibly damaging Het
Ankrd33b T C 15: 31,297,672 Y313C probably damaging Het
Capn15 C T 17: 25,960,178 V940I probably benign Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Cfap57 T C 4: 118,554,712 E1245G probably benign Het
Depdc7 C T 2: 104,724,753 D271N probably damaging Het
Dmtn T C 14: 70,617,430 D10G probably damaging Het
Dusp12 T C 1: 170,880,674 E158G probably damaging Het
Egf C T 3: 129,736,832 G227D probably benign Het
Epha1 C A 6: 42,365,935 E227* probably null Het
Fbxo40 A T 16: 36,970,575 C58S probably damaging Het
Focad A G 4: 88,278,242 T611A unknown Het
Fpr-rs4 C T 17: 18,022,132 Q134* probably null Het
Fsip2 G A 2: 82,983,227 D3297N possibly damaging Het
Garnl3 T C 2: 32,989,525 R930G possibly damaging Het
Hdac4 A T 1: 91,970,948 C695S probably damaging Het
Ier2 G A 8: 84,662,162 T197M probably benign Het
Ift74 T A 4: 94,664,259 probably benign Het
Kat6b A G 14: 21,517,494 D207G possibly damaging Het
Khdrbs2 A T 1: 32,467,862 R196* probably null Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Nrip1 G A 16: 76,293,995 Q225* probably null Het
Olfr114 A G 17: 37,589,931 C141R probably damaging Het
Olfr354 G A 2: 36,907,678 C244Y probably damaging Het
Pdrg1 T C 2: 153,015,271 E17G probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rnf17 C T 14: 56,438,743 P354S probably benign Het
Sh3rf3 T A 10: 59,083,467 Y469N probably damaging Het
Thoc6 T A 17: 23,670,454 probably null Het
Tpm3 C G 3: 90,079,802 A24G probably damaging Het
Tuft1 T C 3: 94,632,623 M93V probably benign Het
Zfp383 T C 7: 29,914,727 S136P probably benign Het
Zfp748 T C 13: 67,542,905 K79E probably damaging Het
Other mutations in Vmn1r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Vmn1r22 UTSW 6 57900528 missense probably benign 0.06
R0415:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
R1132:Vmn1r22 UTSW 6 57900841 missense probably benign 0.43
R1609:Vmn1r22 UTSW 6 57900748 nonsense probably null
R1666:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1668:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1708:Vmn1r22 UTSW 6 57900496 missense possibly damaging 0.46
R1796:Vmn1r22 UTSW 6 57900149 missense probably damaging 1.00
R2359:Vmn1r22 UTSW 6 57900989 start codon destroyed probably null 1.00
R4600:Vmn1r22 UTSW 6 57900875 missense probably damaging 1.00
R5302:Vmn1r22 UTSW 6 57900975 missense possibly damaging 0.87
R5560:Vmn1r22 UTSW 6 57900738 missense probably damaging 1.00
R6026:Vmn1r22 UTSW 6 57900405 missense probably benign 0.00
R6066:Vmn1r22 UTSW 6 57900879 missense probably benign 0.01
R6343:Vmn1r22 UTSW 6 57900578 missense possibly damaging 0.65
R7106:Vmn1r22 UTSW 6 57900311 missense probably damaging 1.00
R7683:Vmn1r22 UTSW 6 57900419 missense probably damaging 1.00
R8126:Vmn1r22 UTSW 6 57900684 missense possibly damaging 0.85
S24628:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ATGTTGTTCATGGGAAAGTGTGAAC -3'
(R):5'- CCCATGGACCTGATCTTATGTC -3'

Sequencing Primer
(F):5'- GGTCTCACTCCTATTGTTAAAACCAC -3'
(R):5'- GGACCTGATCTTATGTCAATTTTCC -3'
Posted On2018-06-22