Incidental Mutation 'R6645:Olfr955'
ID526073
Institutional Source Beutler Lab
Gene Symbol Olfr955
Ensembl Gene ENSMUSG00000063176
Gene Nameolfactory receptor 955
SynonymsMOR171-50, GA_x6K02T2PVTD-33167297-33166353, MOR171-34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6645 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39465801-39471944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39470266 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 153 (L153F)
Ref Sequence ENSEMBL: ENSMUSP00000151246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073946] [ENSMUST00000220176]
Predicted Effect probably benign
Transcript: ENSMUST00000073946
AA Change: L153F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000073602
Gene: ENSMUSG00000063176
AA Change: L153F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Predicted Effect probably benign
Transcript: ENSMUST00000220176
AA Change: L153F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,117 D994V probably benign Het
Anp32e T A 3: 95,937,102 F95I probably damaging Het
Arap1 A G 7: 101,408,111 K628R possibly damaging Het
Arid4b A T 13: 14,120,152 E6D probably damaging Het
Atxn10 G T 15: 85,376,703 probably null Het
Ccdc170 A G 10: 4,560,974 I678V possibly damaging Het
Ccdc18 T A 5: 108,138,930 V110D probably benign Het
Cep85l C T 10: 53,301,672 E322K probably benign Het
Cilp A T 9: 65,279,305 Y894F possibly damaging Het
Ddx4 A G 13: 112,641,174 S62P possibly damaging Het
Dph7 T C 2: 24,965,651 V154A probably benign Het
Ephb6 T C 6: 41,617,272 S579P probably benign Het
Fam53a G T 5: 33,600,784 Q332K probably benign Het
Fancm A G 12: 65,106,100 D1110G probably damaging Het
Fh1 A T 1: 175,614,876 V136E possibly damaging Het
Greb1 G T 12: 16,698,579 H1132Q probably benign Het
Jph1 A G 1: 17,091,761 S226P probably damaging Het
Kbtbd8 C T 6: 95,126,749 R460* probably null Het
Lama5 T A 2: 180,179,670 N3059Y probably damaging Het
Lipc G A 9: 70,803,748 T289I probably damaging Het
Lrrc2 T C 9: 110,970,107 W241R probably damaging Het
Mfn2 T A 4: 147,894,612 I88F probably damaging Het
Mms19 G C 19: 41,955,191 N366K probably benign Het
Myo15 A G 11: 60,477,292 T293A probably benign Het
Ndfip2 T A 14: 105,292,273 Y179N probably damaging Het
Notch4 A G 17: 34,587,816 D1909G probably benign Het
Obscn C T 11: 59,085,262 S2013N probably damaging Het
Oca2 G T 7: 56,314,774 A357S probably benign Het
Olfr902 T C 9: 38,448,923 L17S probably damaging Het
Pde7b C A 10: 20,610,566 probably null Het
Ppef2 T C 5: 92,230,461 N625S probably benign Het
Prom1 A T 5: 44,047,514 L192Q probably damaging Het
Satb2 T C 1: 56,797,007 I542V possibly damaging Het
Sgpp2 C T 1: 78,360,162 T59M probably damaging Het
Skint6 T C 4: 112,892,038 T782A possibly damaging Het
Slc13a4 G T 6: 35,268,839 Q624K probably benign Het
Slc9a3 T A 13: 74,164,172 H629Q probably damaging Het
Slitrk3 G T 3: 73,049,861 A526E probably benign Het
Sptssa T C 12: 54,646,490 Y53C probably damaging Het
Srsf10 T C 4: 135,863,563 S159P possibly damaging Het
Tbce T C 13: 14,005,229 T341A probably benign Het
Tdrd6 A G 17: 43,624,532 L1875P probably benign Het
Tkt G A 14: 30,570,211 G425R probably damaging Het
Tmprss7 T C 16: 45,690,963 I17M possibly damaging Het
Ttc21b T C 2: 66,236,377 S311G probably benign Het
Ubr5 A G 15: 38,029,506 Y492H probably damaging Het
Ush2a T C 1: 188,523,331 I1535T probably damaging Het
Vmn2r17 A T 5: 109,428,381 N373Y probably damaging Het
Vmn2r6 A T 3: 64,556,876 V179E probably damaging Het
Vps13b A G 15: 35,910,305 E3405G probably benign Het
Wac A T 18: 7,973,523 Q212H probably damaging Het
Washc4 C T 10: 83,572,195 R555* probably null Het
Zmat4 G A 8: 23,797,401 probably null Het
Other mutations in Olfr955
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Olfr955 APN 9 39470243 missense probably benign 0.00
IGL02550:Olfr955 APN 9 39470546 missense probably benign 0.42
IGL02743:Olfr955 APN 9 39470246 missense probably benign 0.10
R0029:Olfr955 UTSW 9 39470660 missense probably benign 0.06
R0329:Olfr955 UTSW 9 39470556 missense possibly damaging 0.52
R0610:Olfr955 UTSW 9 39469823 missense probably damaging 0.98
R1420:Olfr955 UTSW 9 39469993 missense probably damaging 1.00
R1636:Olfr955 UTSW 9 39469919 missense probably benign 0.03
R1937:Olfr955 UTSW 9 39470037 missense possibly damaging 0.63
R2655:Olfr955 UTSW 9 39470628 missense probably benign
R2944:Olfr955 UTSW 9 39469938 missense possibly damaging 0.52
R3788:Olfr955 UTSW 9 39470069 missense probably benign 0.03
R4829:Olfr955 UTSW 9 39470367 missense probably damaging 0.99
R5625:Olfr955 UTSW 9 39469803 missense probably benign
R6168:Olfr955 UTSW 9 39470657 missense probably damaging 1.00
R6383:Olfr955 UTSW 9 39470630 missense probably damaging 1.00
R6418:Olfr955 UTSW 9 39469816 missense probably benign 0.07
R7062:Olfr955 UTSW 9 39470057 missense probably benign
R7765:Olfr955 UTSW 9 39470316 missense probably benign 0.28
R7847:Olfr955 UTSW 9 39470505 missense probably benign 0.42
R8122:Olfr955 UTSW 9 39470526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAAGGCCTTGACTCTGCC -3'
(R):5'- CCCAGAATGCATAGCTCAGTTC -3'

Sequencing Primer
(F):5'- TGCCCCCAGAGGATTTAATG -3'
(R):5'- CAGAATGCATAGCTCAGTTCTATTTC -3'
Posted On2018-06-22