Incidental Mutation 'R6571:Vmn2r33'
ID526234
Institutional Source Beutler Lab
Gene Symbol Vmn2r33
Ensembl Gene ENSMUSG00000096691
Gene Namevomeronasal 2, receptor 33
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6571 (G1)
Quality Score142.008
Status Not validated
Chromosome7
Chromosomal Location7550967-7566786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7563669 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000129960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165921]
Predicted Effect probably benign
Transcript: ENSMUST00000165921
AA Change: V148A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129960
Gene: ENSMUSG00000096691
AA Change: V148A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.2e-34 PFAM
Pfam:NCD3G 512 565 4.1e-19 PFAM
Pfam:7tm_3 598 833 3.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,982 D394G probably benign Het
9130019O22Rik T C 7: 127,385,138 probably benign Het
Acsl6 A G 11: 54,325,564 I161V possibly damaging Het
Adamts12 T C 15: 11,065,101 F24S probably benign Het
Bche G T 3: 73,701,491 Q201K probably benign Het
Camsap1 A T 2: 25,939,500 D757E possibly damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dab2ip T C 2: 35,712,890 S399P probably damaging Het
Fbxo40 A T 16: 36,969,306 C481S probably damaging Het
Fn1 T A 1: 71,626,190 T923S probably damaging Het
Gm11437 T C 11: 84,156,212 D147G probably benign Het
Gm5592 A G 7: 41,288,575 E427G probably damaging Het
Gm6401 T A 14: 41,965,495 I125F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Inpp4a T C 1: 37,387,758 M600T probably damaging Het
Itgb6 T C 2: 60,628,456 E374G probably damaging Het
Lrba A C 3: 86,360,060 S1686R probably damaging Het
Map3k4 T C 17: 12,242,692 D1200G possibly damaging Het
Mmp25 T C 17: 23,639,896 H227R probably benign Het
Olfr768 A C 10: 129,093,121 N284K probably damaging Het
Papss2 G A 19: 32,651,942 probably null Het
Rasal2 T A 1: 157,161,179 R718S possibly damaging Het
Rngtt T A 4: 33,379,413 D438E probably damaging Het
S1pr1 A G 3: 115,711,803 S381P possibly damaging Het
Sept8 A G 11: 53,537,163 E268G probably damaging Het
Slc6a21 A G 7: 45,280,879 K234R probably damaging Het
Smg1 A G 7: 118,184,514 probably benign Het
Sntg1 T C 1: 8,363,528 probably benign Het
Spag5 G T 11: 78,321,269 R1041I probably damaging Het
Spata31d1b A T 13: 59,717,455 M806L probably benign Het
Tnfrsf18 T A 4: 156,028,319 L154* probably null Het
Trib2 T C 12: 15,794,059 E194G probably damaging Het
Wiz G A 17: 32,359,324 R405W probably damaging Het
Other mutations in Vmn2r33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Vmn2r33 APN 7 7563777 missense probably benign
R1147:Vmn2r33 UTSW 7 7554145 missense probably benign 0.16
R1147:Vmn2r33 UTSW 7 7554145 missense probably benign 0.16
R3966:Vmn2r33 UTSW 7 7554169 missense probably benign 0.00
R4408:Vmn2r33 UTSW 7 7551230 missense probably damaging 1.00
R6783:Vmn2r33 UTSW 7 7563798 missense probably benign
R7180:Vmn2r33 UTSW 7 7563897 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTATCCTGGAACAACCTAGATTG -3'
(R):5'- CAAATACGCTTTGGCATTGGC -3'

Sequencing Primer
(F):5'- CCTAGATTGACATAAGCATAAGTCC -3'
(R):5'- GGCCTTTGCAATGGATGAAATC -3'
Posted On2018-06-22