Incidental Mutation 'R6689:Lsm3'
ID527887
Institutional Source Beutler Lab
Gene Symbol Lsm3
Ensembl Gene ENSMUSG00000034192
Gene NameLSM3 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms2610005D18Rik, SMX4, USS2, 1010001J12Rik, 6030401D18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R6689 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location91515928-91522625 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GATATATA to GATATATATA at 91519635 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182] [ENSMUST00000040607] [ENSMUST00000206476] [ENSMUST00000206947]
Predicted Effect probably benign
Transcript: ENSMUST00000032182
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040607
SMART Domains Protein: ENSMUSP00000044178
Gene: ENSMUSG00000034192

DomainStartEndE-ValueType
Sm 19 97 3.79e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126253
Predicted Effect probably benign
Transcript: ENSMUST00000150279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205609
Predicted Effect probably benign
Transcript: ENSMUST00000206476
Predicted Effect probably null
Transcript: ENSMUST00000206947
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in Lsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Lsm3 APN 6 91516088 splice site probably benign
R2172:Lsm3 UTSW 6 91522272 missense possibly damaging 0.51
R6552:Lsm3 UTSW 6 91519635 frame shift probably null
R6553:Lsm3 UTSW 6 91519635 frame shift probably null
R6555:Lsm3 UTSW 6 91519635 frame shift probably null
R6588:Lsm3 UTSW 6 91519635 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGTGTAAGTATTGAACCTGTTAC -3'
(R):5'- ACATGACACATTCGTAGAGACC -3'

Sequencing Primer
(F):5'- TGAACCTGTTACTTAAAATCCACTTG -3'
(R):5'- AGGGCACTGTCAAACTCTTG -3'
Posted On2018-07-23