Incidental Mutation 'R6723:Gm5134'
ID529698
Institutional Source Beutler Lab
Gene Symbol Gm5134
Ensembl Gene ENSMUSG00000033255
Gene Namepredicted gene 5134
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6723 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location75954514-76009591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76008619 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 603 (D603G)
Ref Sequence ENSEMBL: ENSMUSP00000097172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099577]
Predicted Effect probably benign
Transcript: ENSMUST00000099577
AA Change: D603G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097172
Gene: ENSMUSG00000033255
AA Change: D603G

DomainStartEndE-ValueType
Pfam:SSF 32 466 2.9e-119 PFAM
transmembrane domain 500 522 N/A INTRINSIC
transmembrane domain 651 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184957
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,289,823 Y2451C possibly damaging Het
Ahnak2 A G 12: 112,778,793 S740P probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Bcl11a C A 11: 24,163,646 P330T probably damaging Het
Cyp2d12 A T 15: 82,556,884 I124F probably benign Het
Dhdds T C 4: 133,994,265 T74A probably damaging Het
Dio3 G A 12: 110,279,557 C109Y possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Efcab3 A T 11: 105,117,080 T329S possibly damaging Het
Esp1 A T 17: 40,728,856 I11L probably benign Het
Fam13b A T 18: 34,498,026 H33Q possibly damaging Het
Fam13c G A 10: 70,554,525 D539N probably damaging Het
Fgd5 A G 6: 91,988,030 T257A probably benign Het
Gtpbp2 T C 17: 46,168,276 V588A probably benign Het
Ift140 A G 17: 25,033,116 I312M probably benign Het
Inpp5j T C 11: 3,500,640 N571S probably damaging Het
Iqgap1 T G 7: 80,723,822 D1473A probably benign Het
Ivl T G 3: 92,571,387 K457T unknown Het
Kdm3b T C 18: 34,793,005 I66T probably damaging Het
Kif21a A T 15: 90,940,446 M1430K probably damaging Het
Klhl25 T A 7: 75,865,991 L215Q possibly damaging Het
Lim2 T A 7: 43,435,675 M163K probably benign Het
Lrig1 T C 6: 94,626,405 D254G probably damaging Het
Mff A G 1: 82,751,666 I122V possibly damaging Het
Mrpl15 A C 1: 4,782,566 probably null Het
Mylk A G 16: 34,929,888 Y1199C possibly damaging Het
Nlrp3 G A 11: 59,565,192 C938Y probably damaging Het
Notch1 T C 2: 26,478,106 N623D probably damaging Het
Obscn T G 11: 59,054,998 E4129A probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1423 A G 19: 12,036,275 S156P probably damaging Het
Olfr173 T C 16: 58,797,432 K138R probably benign Het
Olfr517 A T 7: 108,868,588 C189S probably damaging Het
Olfr808 A T 10: 129,768,415 L306F probably benign Het
Parm1 C T 5: 91,622,997 P291S probably damaging Het
Pcsk1 T A 13: 75,093,069 probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Piezo1 T G 8: 122,507,627 Q93H probably benign Het
Pkd2l2 A T 18: 34,438,157 Y575F probably damaging Het
Plekhn1 A C 4: 156,224,569 F258C probably damaging Het
Pole C T 5: 110,323,616 H1409Y probably benign Het
Rae1 T C 2: 173,012,248 I273T probably damaging Het
Rag1 A G 2: 101,643,645 V384A probably damaging Het
Rnaseh1 T C 12: 28,649,762 L25P probably damaging Het
Serpinb12 A G 1: 106,949,158 H68R probably benign Het
Sh3tc2 A T 18: 61,977,954 I294F probably damaging Het
Sirpb1b A C 3: 15,548,798 L75V possibly damaging Het
Slc12a6 A T 2: 112,337,942 T277S probably damaging Het
Slc7a12 A T 3: 14,499,197 E43D probably benign Het
Spata31d1c T A 13: 65,035,944 D433E probably benign Het
Tbl2 A T 5: 135,159,276 Y308F probably damaging Het
Tfec T C 6: 16,835,302 Y159C probably damaging Het
Tmem8 C A 17: 26,120,636 T616N probably damaging Het
Top1mt G T 15: 75,667,433 T371K probably benign Het
Trim24 T C 6: 37,951,468 V541A probably benign Het
Ttc16 T C 2: 32,768,037 Y456C possibly damaging Het
Ttn G A 2: 76,770,097 R17204* probably null Het
Ugt1a6b T C 1: 88,107,717 V259A probably benign Het
Unc5a T C 13: 54,995,889 W129R probably benign Het
Vmn1r63 T A 7: 5,802,949 H228L probably damaging Het
Whamm G T 7: 81,596,120 V775F probably damaging Het
Zfc3h1 T A 10: 115,420,733 I1536N probably benign Het
Zfp1 T C 8: 111,670,339 S317P probably damaging Het
Zfp58 T C 13: 67,494,073 T52A probably damaging Het
Other mutations in Gm5134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Gm5134 APN 10 76000421 missense possibly damaging 0.70
IGL01371:Gm5134 APN 10 76004747 missense probably damaging 0.99
IGL02140:Gm5134 APN 10 75986111 missense probably benign 0.03
IGL02197:Gm5134 APN 10 75954702 critical splice donor site probably null
IGL02233:Gm5134 APN 10 76008500 critical splice acceptor site probably null
IGL02612:Gm5134 APN 10 75992489 missense probably damaging 1.00
IGL02896:Gm5134 APN 10 75974224 missense possibly damaging 0.82
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0110:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R0499:Gm5134 UTSW 10 75992525 missense probably benign 0.00
R0510:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R1429:Gm5134 UTSW 10 75978381 missense probably damaging 1.00
R1726:Gm5134 UTSW 10 75992527 missense possibly damaging 0.83
R1918:Gm5134 UTSW 10 75976346 missense possibly damaging 0.70
R1956:Gm5134 UTSW 10 76004846 missense possibly damaging 0.89
R1993:Gm5134 UTSW 10 75966393 missense probably damaging 0.96
R2049:Gm5134 UTSW 10 76004884 missense possibly damaging 0.92
R2188:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R3551:Gm5134 UTSW 10 76000447 missense probably benign 0.08
R4074:Gm5134 UTSW 10 76008531 missense probably damaging 1.00
R4435:Gm5134 UTSW 10 75995824 missense probably damaging 1.00
R4466:Gm5134 UTSW 10 76008575 missense probably benign 0.00
R5180:Gm5134 UTSW 10 75976366 missense probably damaging 1.00
R5446:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R5601:Gm5134 UTSW 10 75985952 missense probably damaging 0.98
R5627:Gm5134 UTSW 10 75986108 missense possibly damaging 0.93
R5777:Gm5134 UTSW 10 76004760 missense probably benign 0.00
R5867:Gm5134 UTSW 10 76008616 missense probably benign 0.00
R6145:Gm5134 UTSW 10 75995839 missense probably damaging 0.99
R6232:Gm5134 UTSW 10 75986025 missense possibly damaging 0.95
R6271:Gm5134 UTSW 10 75995809 missense probably benign 0.32
R6329:Gm5134 UTSW 10 75954660 missense possibly damaging 0.68
R7049:Gm5134 UTSW 10 75992458 missense probably damaging 0.97
R7305:Gm5134 UTSW 10 76000399 missense probably damaging 1.00
R7579:Gm5134 UTSW 10 75964437 missense probably damaging 1.00
X0050:Gm5134 UTSW 10 75992510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCATGCTGCTGAATTCAAG -3'
(R):5'- AGCAAGTCCTGGCTCATCAG -3'

Sequencing Primer
(F):5'- ATGCTGCTGAATTCAAGCCTGC -3'
(R):5'- GGCTCATCAGGCAAAATAGACATGC -3'
Posted On2018-08-01