Incidental Mutation 'R6810:Pcdhga12'
ID533784
Institutional Source Beutler Lab
Gene Symbol Pcdhga12
Ensembl Gene ENSMUSG00000102428
Gene Nameprotocadherin gamma subfamily A, 12
Synonymspc2c, Pcdh13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6810 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37765580-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37767179 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 355 (S355P)
Ref Sequence ENSEMBL: ENSMUSP00000036359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000044851] [ENSMUST00000061279] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000193404] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000194928] [ENSMUST00000195112] [ENSMUST00000195363] [ENSMUST00000195764] [ENSMUST00000195823] [ENSMUST00000208907]
Predicted Effect probably benign
Transcript: ENSMUST00000003599
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044851
AA Change: S355P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036359
Gene: ENSMUSG00000102428
AA Change: S355P

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
CA 45 131 3.28e-1 SMART
CA 155 240 1.8e-17 SMART
CA 264 345 9.22e-24 SMART
CA 369 450 1.28e-22 SMART
CA 474 560 1.09e-25 SMART
CA 591 669 9.24e-15 SMART
Pfam:Cadherin_C_2 688 772 3.6e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061279
SMART Domains Protein: ENSMUSP00000058362
Gene: ENSMUSG00000102742

DomainStartEndE-ValueType
CA 45 131 3.23e-2 SMART
CA 155 240 2.22e-17 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 7.09e-25 SMART
CA 474 560 3.55e-25 SMART
CA 591 669 2.53e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 914 933 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091935
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193404
SMART Domains Protein: ENSMUSP00000141359
Gene: ENSMUSG00000102222

DomainStartEndE-ValueType
CA 43 129 2.76e-2 SMART
CA 153 238 1.16e-20 SMART
CA 262 343 1.25e-25 SMART
CA 367 448 4.75e-26 SMART
CA 472 558 3.69e-23 SMART
CA 589 667 3.84e-12 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194928
SMART Domains Protein: ENSMUSP00000141997
Gene: ENSMUSG00000104063

DomainStartEndE-ValueType
CA 47 131 2.48e-6 SMART
CA 155 240 1.57e-17 SMART
CA 264 343 1.29e-27 SMART
CA 367 448 9.14e-28 SMART
CA 472 558 1.24e-24 SMART
CA 589 670 3.73e-10 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 716 721 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195764
SMART Domains Protein: ENSMUSP00000142272
Gene: ENSMUSG00000103081

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 57 132 1.5e-4 SMART
CA 156 241 1.2e-20 SMART
CA 265 346 7.8e-29 SMART
CA 370 451 1.7e-26 SMART
CA 475 561 2.2e-26 SMART
CA 592 673 6.4e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208907
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,066,717 G455R probably damaging Het
Adgrg5 A T 8: 94,933,942 T70S probably damaging Het
Adora1 T C 1: 134,234,039 Y106C probably damaging Het
Aox3 T A 1: 58,141,431 N250K probably benign Het
Ap2b1 A T 11: 83,335,491 Y238F possibly damaging Het
Birc6 G A 17: 74,612,220 S2015N possibly damaging Het
C7 A G 15: 5,007,654 F581L probably damaging Het
Cd27 A T 6: 125,233,664 H203Q probably damaging Het
Cdk2 A G 10: 128,699,587 V274A probably benign Het
Cenpe A G 3: 135,243,822 T1351A probably benign Het
Chd7 T C 4: 8,839,523 L1353P probably damaging Het
Dcc C T 18: 71,370,693 V945M probably damaging Het
Dio1 A G 4: 107,297,725 V118A probably damaging Het
Dst C T 1: 34,212,298 T1818M probably damaging Het
Dthd1 T A 5: 62,814,329 M165K probably benign Het
Eif5b A G 1: 38,046,660 I929V probably benign Het
F5 T A 1: 164,186,902 S581T probably damaging Het
Fanca A C 8: 123,286,477 I761S probably damaging Het
Fat2 T C 11: 55,282,241 T2549A possibly damaging Het
Fut2 A G 7: 45,650,505 L281P probably damaging Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm5431 T C 11: 48,888,976 D651G probably damaging Het
Hook3 A C 8: 26,032,422 probably null Het
Ivd G T 2: 118,869,761 V90L probably benign Het
Klhdc7b A G 15: 89,388,356 Y1147C possibly damaging Het
Mlh1 G A 9: 111,241,558 T363M possibly damaging Het
Ndufa3 A T 7: 3,619,477 I45F probably damaging Het
Nell2 T C 15: 95,241,587 D588G probably damaging Het
Nhlrc3 T C 3: 53,453,575 N253S probably benign Het
Nlrp4c T A 7: 6,066,755 F552I probably damaging Het
Olfr1052 G A 2: 86,297,923 A36T probably benign Het
Olfr578 A C 7: 102,984,835 S110A probably damaging Het
Pcdhga7 A T 18: 37,715,873 Y311F probably benign Het
Phldb2 A G 16: 45,748,725 probably null Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Plxna4 A G 6: 32,310,522 V480A probably benign Het
Psrc1 A T 3: 108,385,348 K152N possibly damaging Het
Ptcd3 A C 6: 71,885,532 V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,152,732 probably null Het
Skint6 T C 4: 112,948,380 probably null Het
Slc24a1 A G 9: 64,948,323 V434A probably benign Het
Snd1 T A 6: 28,668,610 V432E probably benign Het
Syne2 C T 12: 75,942,885 T1847M probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tes C A 6: 17,104,652 N377K probably benign Het
Tfip11 T A 5: 112,333,597 I452N probably benign Het
Tgfbi T C 13: 56,637,203 S658P probably benign Het
Tmx4 A C 2: 134,620,674 D112E probably damaging Het
Tnn G T 1: 160,104,842 D1367E probably damaging Het
Triobp A G 15: 78,966,615 N323S possibly damaging Het
Usp40 T C 1: 87,981,033 D582G probably benign Het
Vmn2r99 A G 17: 19,380,034 K440R probably benign Het
Zfp707 T A 15: 75,974,899 L193Q probably damaging Het
Zfp748 T C 13: 67,541,725 Y472C probably damaging Het
Other mutations in Pcdhga12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3946:Pcdhga12 UTSW 18 37767629 missense probably benign 0.00
R3964:Pcdhga12 UTSW 18 37767201 missense probably benign
R4169:Pcdhga12 UTSW 18 37766414 missense probably benign
R4363:Pcdhga12 UTSW 18 37766161 missense probably benign
R4409:Pcdhga12 UTSW 18 37768085 missense probably damaging 0.99
R4754:Pcdhga12 UTSW 18 37766551 missense probably damaging 1.00
R4863:Pcdhga12 UTSW 18 37768281 missense probably benign 0.36
R4890:Pcdhga12 UTSW 18 37768237 missense possibly damaging 0.72
R5029:Pcdhga12 UTSW 18 37766811 missense probably benign 0.11
R5114:Pcdhga12 UTSW 18 37768107 missense probably benign 0.10
R5274:Pcdhga12 UTSW 18 37766422 nonsense probably null
R5276:Pcdhga12 UTSW 18 37766675 missense possibly damaging 0.92
R5389:Pcdhga12 UTSW 18 37766732 missense probably damaging 1.00
R5454:Pcdhga12 UTSW 18 37766261 missense possibly damaging 0.46
R5615:Pcdhga12 UTSW 18 37768079 missense probably damaging 0.98
R5704:Pcdhga12 UTSW 18 37767369 missense probably damaging 1.00
R5825:Pcdhga12 UTSW 18 37768503 missense possibly damaging 0.84
R5982:Pcdhga12 UTSW 18 37768031 missense probably damaging 1.00
R7330:Pcdhga12 UTSW 18 37768386 missense probably damaging 0.99
R7611:Pcdhga12 UTSW 18 37768425 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GACAAGGCAGCGAAAGTTTTC -3'
(R):5'- TGTAACTAGGAACCTCTTCTCGG -3'

Sequencing Primer
(F):5'- TTCAAGCTGGACAGTAACTTGG -3'
(R):5'- TAGGAACCTCTTCTCGGTCCAGG -3'
Posted On2018-09-12