Incidental Mutation 'R6810:Gm19410'
ID 533761
Institutional Source Beutler Lab
Gene Symbol Gm19410
Ensembl Gene ENSMUSG00000109372
Gene Name predicted gene, 19410
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R6810 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 35765790-35818047 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 35772579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 143 (A143E)
Ref Sequence ENSEMBL: ENSMUSP00000147162 (fasta)
AlphaFold A0A140LJC7
Predicted Effect probably damaging
Transcript: ENSMUST00000207505
AA Change: A143E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,066,717 G455R probably damaging Het
Adgrg5 A T 8: 94,933,942 T70S probably damaging Het
Adora1 T C 1: 134,234,039 Y106C probably damaging Het
Aox3 T A 1: 58,141,431 N250K probably benign Het
Ap2b1 A T 11: 83,335,491 Y238F possibly damaging Het
Birc6 G A 17: 74,612,220 S2015N possibly damaging Het
C7 A G 15: 5,007,654 F581L probably damaging Het
Cd27 A T 6: 125,233,664 H203Q probably damaging Het
Cdk2 A G 10: 128,699,587 V274A probably benign Het
Cenpe A G 3: 135,243,822 T1351A probably benign Het
Chd7 T C 4: 8,839,523 L1353P probably damaging Het
Dcc C T 18: 71,370,693 V945M probably damaging Het
Dio1 A G 4: 107,297,725 V118A probably damaging Het
Dst C T 1: 34,212,298 T1818M probably damaging Het
Dthd1 T A 5: 62,814,329 M165K probably benign Het
Eif5b A G 1: 38,046,660 I929V probably benign Het
F5 T A 1: 164,186,902 S581T probably damaging Het
Fanca A C 8: 123,286,477 I761S probably damaging Het
Fat2 T C 11: 55,282,241 T2549A possibly damaging Het
Fut2 A G 7: 45,650,505 L281P probably damaging Het
Gm5431 T C 11: 48,888,976 D651G probably damaging Het
Hook3 A C 8: 26,032,422 probably null Het
Ivd G T 2: 118,869,761 V90L probably benign Het
Klhdc7b A G 15: 89,388,356 Y1147C possibly damaging Het
Mlh1 G A 9: 111,241,558 T363M possibly damaging Het
Ndufa3 A T 7: 3,619,477 I45F probably damaging Het
Nell2 T C 15: 95,241,587 D588G probably damaging Het
Nhlrc3 T C 3: 53,453,575 N253S probably benign Het
Nlrp4c T A 7: 6,066,755 F552I probably damaging Het
Olfr1052 G A 2: 86,297,923 A36T probably benign Het
Olfr578 A C 7: 102,984,835 S110A probably damaging Het
Pcdhga12 T C 18: 37,767,179 S355P probably benign Het
Pcdhga7 A T 18: 37,715,873 Y311F probably benign Het
Phldb2 A G 16: 45,748,725 probably null Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Plxna4 A G 6: 32,310,522 V480A probably benign Het
Psrc1 A T 3: 108,385,348 K152N possibly damaging Het
Ptcd3 A C 6: 71,885,532 V473G probably damaging Het
Rab11fip1 ACTCT ACT 8: 27,152,732 probably null Het
Skint6 T C 4: 112,948,380 probably null Het
Slc24a1 A G 9: 64,948,323 V434A probably benign Het
Snd1 T A 6: 28,668,610 V432E probably benign Het
Syne2 C T 12: 75,942,885 T1847M probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tes C A 6: 17,104,652 N377K probably benign Het
Tfip11 T A 5: 112,333,597 I452N probably benign Het
Tgfbi T C 13: 56,637,203 S658P probably benign Het
Tmx4 A C 2: 134,620,674 D112E probably damaging Het
Tnn G T 1: 160,104,842 D1367E probably damaging Het
Triobp A G 15: 78,966,615 N323S possibly damaging Het
Usp40 T C 1: 87,981,033 D582G probably benign Het
Vmn2r99 A G 17: 19,380,034 K440R probably benign Het
Zfp707 T A 15: 75,974,899 L193Q probably damaging Het
Zfp748 T C 13: 67,541,725 Y472C probably damaging Het
Other mutations in Gm19410
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Gm19410 UTSW 8 35795599 missense probably damaging 0.98
BB019:Gm19410 UTSW 8 35795599 missense probably damaging 0.98
R0046:Gm19410 UTSW 8 35802645 missense probably benign 0.31
R6026:Gm19410 UTSW 8 35812426 missense probably benign 0.03
R6039:Gm19410 UTSW 8 35809364 missense probably benign 0.44
R6039:Gm19410 UTSW 8 35809364 missense probably benign 0.44
R6185:Gm19410 UTSW 8 35807510 missense possibly damaging 0.87
R6239:Gm19410 UTSW 8 35778764 missense probably damaging 0.98
R6303:Gm19410 UTSW 8 35807560 missense possibly damaging 0.96
R6377:Gm19410 UTSW 8 35803582 nonsense probably null
R6545:Gm19410 UTSW 8 35790498 missense possibly damaging 0.93
R6700:Gm19410 UTSW 8 35807510 missense possibly damaging 0.87
R6720:Gm19410 UTSW 8 35807576 missense probably benign 0.12
R6795:Gm19410 UTSW 8 35795522 missense probably damaging 0.98
R6808:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6811:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6966:Gm19410 UTSW 8 35817973 missense possibly damaging 0.84
R7264:Gm19410 UTSW 8 35785766 missense probably benign 0.01
R7267:Gm19410 UTSW 8 35814843 missense possibly damaging 0.80
R7355:Gm19410 UTSW 8 35807072 missense probably benign 0.00
R7423:Gm19410 UTSW 8 35804607 missense probably benign 0.28
R7494:Gm19410 UTSW 8 35795530 missense probably damaging 0.99
R7516:Gm19410 UTSW 8 35796279 missense probably benign 0.30
R7517:Gm19410 UTSW 8 35773618 missense possibly damaging 0.45
R7526:Gm19410 UTSW 8 35790612 missense probably damaging 0.98
R7527:Gm19410 UTSW 8 35802232 missense probably damaging 0.99
R7545:Gm19410 UTSW 8 35802625 missense probably damaging 0.99
R7549:Gm19410 UTSW 8 35799346 missense probably benign 0.20
R7564:Gm19410 UTSW 8 35806997 missense probably benign 0.00
R7615:Gm19410 UTSW 8 35796359 missense probably damaging 1.00
R7622:Gm19410 UTSW 8 35810347 missense possibly damaging 0.91
R7655:Gm19410 UTSW 8 35809099 missense probably benign
R7656:Gm19410 UTSW 8 35809099 missense probably benign
R7703:Gm19410 UTSW 8 35799385 missense probably damaging 0.98
R7750:Gm19410 UTSW 8 35807498 missense possibly damaging 0.68
R7760:Gm19410 UTSW 8 35802337 missense probably damaging 0.99
R7837:Gm19410 UTSW 8 35808980 missense possibly damaging 0.91
R7932:Gm19410 UTSW 8 35795599 missense probably damaging 0.98
R7942:Gm19410 UTSW 8 35771786 missense probably damaging 0.98
R7970:Gm19410 UTSW 8 35815647 missense probably benign 0.00
R8088:Gm19410 UTSW 8 35806841 missense probably benign 0.45
R8228:Gm19410 UTSW 8 35785838 missense possibly damaging 0.53
R8382:Gm19410 UTSW 8 35809148 missense probably damaging 0.99
R8757:Gm19410 UTSW 8 35808965 missense possibly damaging 0.83
R8879:Gm19410 UTSW 8 35771868 missense probably damaging 0.99
R9010:Gm19410 UTSW 8 35814857 missense probably benign 0.02
R9060:Gm19410 UTSW 8 35802326 missense probably damaging 1.00
R9088:Gm19410 UTSW 8 35773612 missense probably damaging 1.00
R9104:Gm19410 UTSW 8 35780467 missense probably damaging 0.99
R9186:Gm19410 UTSW 8 35815475 missense possibly damaging 0.90
R9290:Gm19410 UTSW 8 35802232 missense probably damaging 0.99
R9334:Gm19410 UTSW 8 35803568 nonsense probably null
R9398:Gm19410 UTSW 8 35805202 missense probably benign 0.00
R9439:Gm19410 UTSW 8 35781656 missense probably damaging 0.96
R9445:Gm19410 UTSW 8 35772498 missense possibly damaging 0.75
R9511:Gm19410 UTSW 8 35790694 missense probably damaging 0.99
R9520:Gm19410 UTSW 8 35795483 missense probably benign 0.15
R9523:Gm19410 UTSW 8 35790454 missense probably benign 0.01
R9669:Gm19410 UTSW 8 35780339 missense possibly damaging 0.45
R9711:Gm19410 UTSW 8 35812339 missense possibly damaging 0.85
R9728:Gm19410 UTSW 8 35780440 missense possibly damaging 0.95
R9759:Gm19410 UTSW 8 35785784 missense possibly damaging 0.53
Z1176:Gm19410 UTSW 8 35792611 missense possibly damaging 0.79
Z1177:Gm19410 UTSW 8 35808965 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGCCCATCATAATCCAGCAG -3'
(R):5'- CCTCTTCTTTGAGAAAGGATGGC -3'

Sequencing Primer
(F):5'- GCCCATCATAATCCAGCAGTTCTC -3'
(R):5'- TAAAGCAGCCTGTGTACTATACCCTG -3'
Posted On 2018-09-12