Incidental Mutation 'R6895:Capn8'
ID538270
Institutional Source Beutler Lab
Gene Symbol Capn8
Ensembl Gene ENSMUSG00000038599
Gene Namecalpain 8
SynonymsnCL-2, nCL-2'
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location182565007-182632352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 182628669 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 661 (D661E)
Ref Sequence ENSEMBL: ENSMUSP00000047164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048941] [ENSMUST00000192671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048941
AA Change: D661E

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047164
Gene: ENSMUSG00000038599
AA Change: D661E

DomainStartEndE-ValueType
CysPc 27 352 5.02e-183 SMART
calpain_III 355 512 5.34e-91 SMART
EFh 579 607 3.12e0 SMART
EFh 609 637 4.32e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192671
AA Change: T683N
SMART Domains Protein: ENSMUSP00000141275
Gene: ENSMUSG00000038599
AA Change: T683N

DomainStartEndE-ValueType
CysPc 27 352 2.2e-185 SMART
calpain_III 355 512 1.4e-93 SMART
EFh 579 607 1.5e-2 SMART
EFh 609 637 2.1e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele or allele that produces a proteolytically inactive protein exhibit increased sensitivity to ethanol-induced gastric mucosa injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Capn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01880:Capn8 APN 1 182597576 missense probably damaging 1.00
IGL02814:Capn8 APN 1 182598771 missense probably damaging 1.00
R0063:Capn8 UTSW 1 182602112 missense probably damaging 1.00
R0063:Capn8 UTSW 1 182602112 missense probably damaging 1.00
R0330:Capn8 UTSW 1 182630138 missense probably benign 0.30
R1653:Capn8 UTSW 1 182623951 missense probably benign 0.04
R1679:Capn8 UTSW 1 182613467 missense probably damaging 1.00
R1783:Capn8 UTSW 1 182598822 missense probably damaging 1.00
R1819:Capn8 UTSW 1 182598826 missense probably damaging 1.00
R1831:Capn8 UTSW 1 182611101 critical splice donor site probably null
R2045:Capn8 UTSW 1 182613386 missense probably benign 0.00
R2298:Capn8 UTSW 1 182613420 missense probably benign 0.29
R4331:Capn8 UTSW 1 182604454 missense probably damaging 1.00
R4485:Capn8 UTSW 1 182598741 missense possibly damaging 0.76
R4835:Capn8 UTSW 1 182604551 missense probably damaging 0.98
R5055:Capn8 UTSW 1 182571961 missense probably damaging 1.00
R5224:Capn8 UTSW 1 182596989 missense probably damaging 1.00
R5327:Capn8 UTSW 1 182628604 missense probably benign 0.03
R5497:Capn8 UTSW 1 182620180 missense probably benign
R6307:Capn8 UTSW 1 182607699 missense probably damaging 0.98
R7216:Capn8 UTSW 1 182598798 missense possibly damaging 0.89
R7438:Capn8 UTSW 1 182598675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCCACAGAATCATGGATGGC -3'
(R):5'- GCCCCTAAAGTGTCTATCGTC -3'

Sequencing Primer
(F):5'- AGAATCATGGATGGCCCCTGTG -3'
(R):5'- ATCGTCCCATCCTCATGAATATCAG -3'
Posted On2018-11-06