Mutagenetix > Incidental Mutation

Incidental Mutation 'R6895:Nup93'

538288

Institutional Source

Beutler Lab

Gene Symbol

Nup93

Ensembl Gene

ENSMUSG00000032939

Gene Name

nucleoporin 93

Synonyms

2410008G02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.912) question?

Stock #

R6895 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94214564-94317227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 94243686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 71 (I71K)

Ref Sequence

ENSEMBL: ENSMUSP00000148700 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000212824]

AlphaFold

Q8BJ71

Predicted Effect

probably damaging
Transcript: ENSMUST00000079961
AA Change: I71K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: I71K

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	214	804	6.9e-198	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109547
AA Change: I71K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: I71K

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	202	804	8.2e-202	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212824
AA Change: I71K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.8554

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd29	A	G	18: 12,260,989	V256A	probably benign	Het
Arid4a	A	G	12: 71,063,302	D139G	probably benign	Het
AU040320	T	C	4: 126,791,930	W100R	probably damaging	Het
C4bp	T	C	1: 130,636,206	*470W	probably null	Het
Capn8	C	A	1: 182,628,669	D661E	possibly damaging	Het
Car14	T	C	3: 95,898,160	T334A	probably benign	Het
Chd6	T	A	2: 160,988,340	T1012S	probably damaging	Het
Csmd3	T	C	15: 47,666,514		probably null	Het
Dnaaf2	A	G	12: 69,197,663	V208A	probably benign	Het
Dnah11	A	G	12: 117,995,191	W2986R	probably damaging	Het
Epb42	G	A	2: 121,036,623		probably benign	Het
Fam120a	A	G	13: 48,892,021	F780L	probably benign	Het
Gm4788	G	A	1: 139,740,472	P308S	possibly damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Grid2	T	C	6: 64,395,299	F655S	probably damaging	Het
Homer3	T	C	8: 70,285,305	S2P	probably damaging	Het
Hydin	T	C	8: 110,312,251	V207A	probably benign	Het
Inpp5j	T	C	11: 3,495,557		probably null	Het
Jak1	C	T	4: 101,154,537		probably null	Het
Jmjd1c	A	G	10: 67,217,090	I220V	probably benign	Het
Kat6a	T	G	8: 22,935,783	S1115A	possibly damaging	Het
Larp4	T	G	15: 100,007,730		probably null	Het
Lrrc72	T	G	12: 36,209,718	D43A	probably damaging	Het
Mptx2	A	C	1: 173,277,685	V13G	probably benign	Het
Nmbr	A	T	10: 14,769,960	*258Y	probably null	Het
Nup210l	C	T	3: 90,159,924	A757V	probably damaging	Het
Nup62	A	G	7: 44,829,733	K391E	possibly damaging	Het
Olfr294	A	T	7: 86,616,115	C177S	probably damaging	Het
Olfr916	A	C	9: 38,658,089	L101R	probably damaging	Het
Pik3cg	A	G	12: 32,204,347	M547T	possibly damaging	Het
Ropn1	A	T	16: 34,677,298	I187F	possibly damaging	Het
Rtp3	T	C	9: 110,987,196	R96G	possibly damaging	Het
Sfrp5	A	T	19: 42,199,788	S197R	probably damaging	Het
Slc12a6	A	G	2: 112,355,095	H903R	probably damaging	Het
Slc26a3	G	T	12: 31,463,524	A482S	probably damaging	Het
Slc2a12	G	T	10: 22,692,185	A504S	probably damaging	Het
Slitrk5	C	A	14: 111,681,653	P903Q	probably damaging	Het
Tas2r123	A	T	6: 132,847,170	H10L	probably benign	Het
Tex46	T	C	4: 136,612,901	V99A	probably benign	Het
Top2b	T	C	14: 16,413,604	V1024A	probably benign	Het
Ugt2b36	G	A	5: 87,092,298	T76I	probably benign	Het
Usp31	G	T	7: 121,653,176	T747K	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Nup93

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Nup93	APN	8	94309023	critical splice donor site	probably null
IGL01652:Nup93	APN	8	94296559	missense	possibly damaging	0.93
IGL02003:Nup93	APN	8	94302109	nonsense	probably null
IGL02169:Nup93	APN	8	94302129	missense	probably damaging	1.00
IGL02212:Nup93	APN	8	94311662	critical splice donor site	probably null
IGL02551:Nup93	APN	8	94227833	nonsense	probably null
IGL02568:Nup93	APN	8	94309635	missense	probably damaging	1.00
IGL03094:Nup93	APN	8	94296502	missense	probably benign
IGL03248:Nup93	APN	8	94306088	missense	probably damaging	0.98
IGL03273:Nup93	APN	8	94306277	missense	probably benign	0.01
IGL03401:Nup93	APN	8	94309711	splice site	probably null
PIT4585001:Nup93	UTSW	8	94243727	missense	probably benign	0.25
R0409:Nup93	UTSW	8	94303665	missense	probably damaging	1.00
R0748:Nup93	UTSW	8	94307943	missense	probably damaging	1.00
R0891:Nup93	UTSW	8	94281263	splice site	probably benign
R1667:Nup93	UTSW	8	94292687	missense	possibly damaging	0.71
R1696:Nup93	UTSW	8	94296555	missense	probably benign	0.29
R1862:Nup93	UTSW	8	94306102	missense	probably damaging	1.00
R2069:Nup93	UTSW	8	94243739	missense	probably damaging	1.00
R2143:Nup93	UTSW	8	94296480	nonsense	probably null
R2187:Nup93	UTSW	8	94300850	missense	probably damaging	1.00
R2228:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2229:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2254:Nup93	UTSW	8	94227857	critical splice donor site	probably null
R2884:Nup93	UTSW	8	94303638	missense	probably damaging	1.00
R4521:Nup93	UTSW	8	94314636	missense	probably damaging	1.00
R4563:Nup93	UTSW	8	94307892	missense	probably damaging	1.00
R4900:Nup93	UTSW	8	94286603	missense	probably benign	0.25
R5570:Nup93	UTSW	8	94314670	missense	probably damaging	1.00
R6226:Nup93	UTSW	8	94286537	missense	probably damaging	1.00
R6489:Nup93	UTSW	8	94302088	missense	probably benign	0.10
R6658:Nup93	UTSW	8	94304179	missense	probably benign	0.02
R6817:Nup93	UTSW	8	94314682	critical splice donor site	probably null
R6955:Nup93	UTSW	8	94309673	missense	probably damaging	0.96
R7476:Nup93	UTSW	8	94303632	missense	probably damaging	1.00
R7643:Nup93	UTSW	8	94286619	critical splice donor site	probably null
R7994:Nup93	UTSW	8	94306302	missense	probably benign	0.15
R8461:Nup93	UTSW	8	94281335	critical splice donor site	probably null
R9177:Nup93	UTSW	8	94227743	missense	probably benign	0.25
R9264:Nup93	UTSW	8	94292720	missense	probably benign	0.01
R9532:Nup93	UTSW	8	94314621	missense	probably damaging	1.00
R9567:Nup93	UTSW	8	94308976	missense	possibly damaging	0.94
R9629:Nup93	UTSW	8	94306639	missense	probably damaging	0.99
R9721:Nup93	UTSW	8	94303685	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGGTTTTCCAGTCAGGTGC -3'
(R):5'- CTCTTGTGTTCCTCGGTAAGAAG -3'

Sequencing Primer
(F):5'- AAGGTTTTCCAGTCAGGTGCTCTAC -3'
(R):5'- GGGTACAAGCTCTACTGTG -3'

Posted On

2018-11-06