Incidental Mutation 'R6942:Fktn'
ID540587
Institutional Source Beutler Lab
Gene Symbol Fktn
Ensembl Gene ENSMUSG00000028414
Gene Namefukutin
SynonymsFukutin, Fcmd
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6942 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location53713998-53777890 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 53735128 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061771] [ENSMUST00000107638] [ENSMUST00000128667] [ENSMUST00000221657] [ENSMUST00000222290]
Predicted Effect probably null
Transcript: ENSMUST00000061771
SMART Domains Protein: ENSMUSP00000061489
Gene: ENSMUSG00000028414

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107638
SMART Domains Protein: ENSMUSP00000138774
Gene: ENSMUSG00000028414

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128667
SMART Domains Protein: ENSMUSP00000114699
Gene: ENSMUSG00000028414

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000221657
Predicted Effect probably benign
Transcript: ENSMUST00000222290
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative transmembrane protein that is localized to the cis-Golgi compartment, where it may be involved in the glycosylation of alpha-dystroglycan in skeletal muscle. The encoded protein is thought to be a glycosyltransferase and could play a role in brain development. Defects in this gene are a cause of Fukuyama-type congenital muscular dystrophy (FCMD), Walker-Warburg syndrome (WWS), limb-girdle muscular dystrophy type 2M (LGMD2M), and dilated cardiomyopathy type 1X (CMD1X). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice die by E9.5. Embryos exhibit diverse phenotypes such as growth retardation, folding of the egg cylinder, leakage of maternal red blood cells into the yolk sac cavity, increased number of apoptotic cells in the ectoderm, and thin and breached basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,261 D273E probably benign Het
Acacb T C 5: 114,191,963 probably null Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cdh23 G A 10: 60,438,856 T483I possibly damaging Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Cyp11b2 G A 15: 74,856,245 probably benign Het
Cyp2j12 A T 4: 96,112,864 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dpp6 G A 5: 27,469,459 V140M possibly damaging Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Grin3b T A 10: 79,976,119 probably null Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Ino80 A G 2: 119,383,502 F1196L probably damaging Het
Iqsec3 C T 6: 121,473,103 C154Y probably damaging Het
Kank1 A T 19: 25,424,173 D1048V possibly damaging Het
Kif2c A G 4: 117,166,378 L379P probably damaging Het
Kpna6 A T 4: 129,651,721 probably null Het
Large2 C T 2: 92,370,822 R28H probably damaging Het
Map4k2 T A 19: 6,346,709 W552R possibly damaging Het
Mark3 A G 12: 111,592,654 I43M probably null Het
Med13l C A 5: 118,745,006 probably null Het
Mtbp T A 15: 55,567,200 Y218N probably damaging Het
Olfr669 C T 7: 104,938,897 R124C possibly damaging Het
Pcdhgb5 T C 18: 37,732,643 L497P probably damaging Het
Pkhd1l1 A G 15: 44,522,629 T1221A probably damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Serpinb9g A T 13: 33,494,905 T253S probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tep1 A G 14: 50,836,737 V1897A possibly damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Tmem70 T A 1: 16,677,156 Y166N probably damaging Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Ttn A G 2: 76,901,846 probably benign Het
Unc79 T A 12: 103,122,445 probably null Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Zfyve16 A T 13: 92,516,631 N815K probably benign Het
Other mutations in Fktn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fktn APN 4 53734866 missense probably benign 0.17
IGL00562:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00563:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00972:Fktn APN 4 53734992 missense probably damaging 1.00
IGL01025:Fktn APN 4 53737568 missense possibly damaging 0.51
IGL02329:Fktn APN 4 53720181 missense probably benign 0.40
IGL03149:Fktn APN 4 53744653 missense probably benign
IGL03310:Fktn APN 4 53720120 nonsense probably null
beijing UTSW 4 53734880 missense probably damaging 1.00
R0257:Fktn UTSW 4 53734898 missense probably benign 0.09
R0311:Fktn UTSW 4 53744620 missense probably benign 0.10
R1368:Fktn UTSW 4 53734880 missense probably damaging 1.00
R1500:Fktn UTSW 4 53735065 missense probably benign
R1654:Fktn UTSW 4 53761220 missense probably benign 0.01
R1757:Fktn UTSW 4 53747003 splice site probably benign
R2007:Fktn UTSW 4 53735099 missense possibly damaging 0.56
R4308:Fktn UTSW 4 53724617 intron probably benign
R4374:Fktn UTSW 4 53720201 missense probably damaging 0.99
R4798:Fktn UTSW 4 53744637 missense probably benign 0.01
R5563:Fktn UTSW 4 53761327 missense probably damaging 1.00
R5913:Fktn UTSW 4 53735035 nonsense probably null
R5997:Fktn UTSW 4 53735061 missense probably benign 0.00
R6227:Fktn UTSW 4 53731136 missense probably benign
R7832:Fktn UTSW 4 53734859 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTTCAATGCCTAAAGACTGAAAGC -3'
(R):5'- TTTGCCTTGAGACACTCACC -3'

Sequencing Primer
(F):5'- TCCTCGGCTAGATGGAATAGACTC -3'
(R):5'- TTGAGACACTCACCACTGTGG -3'
Posted On2018-11-06